FvH4_3g23350

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
16393584 .. 16396678
3095 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g23350.t5

Sequence Viewer

Length: 255 bp
ATGAAGAAAGGATTGCACCCTCAGATGCAATGGGTGTCTTACGTGACACAGAGTGGGAGACTGATGCACGTTATGATGACCAAGATACACCATGTTGGAAAAGTCTACCACTTGAAGGCTAAGCGCCAAATGGCTGAGAACCTCGGCCAGGTTGCCAAGTTTAAGCAACGGATTTTGGTACAAACAAAAATCTACCAAGCAGGACTAAAAGAAGCCCTCTGGCTATTGCAAAATGCTTTGAAACAGCGGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.88

Weight (kDa)

10.54

Isoelectric Point (pI)

33.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 105
AciI CCGC 1 cut(s) 247
AcoI YGGCCR 1 cut(s) 145
AdeI CACNNNGTG 1 cut(s) 53
AfaI GTAC 1 cut(s) 180
AfiI CCNNNNNNNGG 2 cut(s) 115, 148
AgsI TTSAA 2 cut(s) 115, 241
AjnI CCWGG 1 cut(s) 147
Alw26I GTCTC 1 cut(s) 52
AoxI GGCC 1 cut(s) 145
AspLEI GCGC 1 cut(s) 126
BciT130I CCWGG 1 cut(s) 149
BcoDI GTCTC 1 cut(s) 52
BfoI RGCGCY 1 cut(s) 127
BlpI GCTNAGC 1 cut(s) 120
Bme1390I CCNGG 1 cut(s) 149
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 2 cut(s) 15, 54
Bpu1102I GCTNAGC 1 cut(s) 120
BsaAI YACGTR 1 cut(s) 43
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 2 cut(s) 115, 148
Bse3DI GCAATG 1 cut(s) 35
BseBI CCWGG 1 cut(s) 149
BseDI CCNNGG 1 cut(s) 142
BseLI CCNNNNNNNGG 2 cut(s) 115, 148
BseMI GCAATG 1 cut(s) 35
BseMII CTCAG 2 cut(s) 35, 126
BshFI GGCC 1 cut(s) 147
BslI CCNNNNNNNGG 2 cut(s) 115, 148
BsmAI GTCTC 1 cut(s) 52
BsnI GGCC 1 cut(s) 147
Bsp1720I GCTNAGC 1 cut(s) 120
BspACI CCGC 1 cut(s) 247
BspANI GGCC 1 cut(s) 147
BspCNI CTCAG 2 cut(s) 34, 127
BsrDI GCAATG 1 cut(s) 35
BssECI CCNNGG 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 149
BstBAI YACGTR 1 cut(s) 43
BstDEI CTNAG 3 cut(s) 21, 120, 135
BstENI CCTNNNNNAGG 1 cut(s) 146
BstH2I RGCGCY 1 cut(s) 127
BstHHI GCGC 1 cut(s) 126
BstMAI GTCTC 1 cut(s) 52
BstNI CCWGG 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 147
BsuRI GGCC 1 cut(s) 147
CfoI GCGC 1 cut(s) 126
Csp6I GTAC 1 cut(s) 179
CviAII CATG 1 cut(s) 92
CviJI RGCY 5 cut(s) 119, 134, 147, 215, 223
CviKI_1 RGCY 5 cut(s) 119, 134, 147, 215, 223
CviQI GTAC 1 cut(s) 179
DdeI CTNAG 3 cut(s) 21, 120, 135
DraIII CACNNNGTG 1 cut(s) 53
EaeI YGGCCR 1 cut(s) 145
EcoNI CCTNNNNNAGG 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 147
FaeI CATG 1 cut(s) 95
FaiI YATR 2 cut(s) 74, 93
FatI CATG 1 cut(s) 91
FauI CCCGC 1 cut(s) 240
FblI GTMKAC 1 cut(s) 105
GlaI GCGC 1 cut(s) 125
HaeII RGCGCY 1 cut(s) 127
HaeIII GGCC 1 cut(s) 147
HhaI GCGC 1 cut(s) 126
Hin1II CATG 1 cut(s) 95
Hin6I GCGC 1 cut(s) 124
HinP1I GCGC 1 cut(s) 124
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 24
Hpy8I GTNNAC 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 109
HpyCH4IV ACGT 2 cut(s) 42, 69
HpyCH4V TGCA 4 cut(s) 16, 28, 67, 229
HpyF3I CTNAG 3 cut(s) 21, 120, 135
HpySE526I ACGT 2 cut(s) 42, 69
Hsp92II CATG 1 cut(s) 95
HspAI GCGC 1 cut(s) 124
LpnPI CCDG 4 cut(s) 134, 161, 186, 205
LweI GCATC 2 cut(s) 15, 54
MaeII ACGT 2 cut(s) 42, 69
MaeIII GTNAC 1 cut(s) 43
MboII GAAGA 1 cut(s) 16
MmeI TCCRAC 1 cut(s) 76
MnlI CCTC 3 cut(s) 30, 152, 227
MseI TTAA 1 cut(s) 162
MspA1I CMGCKG 1 cut(s) 247
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
NlaIII CATG 1 cut(s) 95
NmeAIII GCCGAG 1 cut(s) 123
NmuCI GTSAC 1 cut(s) 43
Ppu21I YACGTR 1 cut(s) 43
Psp6I CCWGG 1 cut(s) 147
PspGI CCWGG 1 cut(s) 147
RsaI GTAC 1 cut(s) 180
RsaNI GTAC 1 cut(s) 179
SaqAI TTAA 1 cut(s) 162
ScrFI CCNGG 1 cut(s) 149
SetI ASST 4 cut(s) 45, 72, 144, 153
SfaNI GCATC 2 cut(s) 15, 54
SsiI CCGC 1 cut(s) 247
StyD4I CCNGG 1 cut(s) 147
TaiI ACGT 2 cut(s) 45, 72
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TseFI GTSAC 1 cut(s) 43
Tsp45I GTSAC 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 184
XagI CCTNNNNNAGG 1 cut(s) 146
XmiI GTMKAC 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.