FvH4_3g32730

Belongs to the syntaxin family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
28041601 .. 28043881
2281 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g32730.t1

Sequence Viewer

Length: 285 bp
ATGCGGAAGACGAGACAGGATCAAGGTCTAGATATCATATCAGAAGGATTGGGTACGCTGAAAGAATTGGCACAAGATATGAATGAGGAAATGGATCGACAGGTCCCGTTAATTGATGAGATAGATACGAAGGTGGATAAGGTGACATCTGACATTAAAAATAATAATGTGAGGCTTAAGGAAAATCTTTACAAGATGAGATCGAGCCGAAATTTCTGCATTGATATTACTTTGCTGTGTATAATTCTGGGGATCGCCTTATATCTATACAATATACTGAGATGA

Protein Analysis

95

Amino Acids

10.93

Weight (kDa)

5.39

Isoelectric Point (pI)

35.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SNARE PF05739 37 - 87 1.2e-10 SNARE domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011717)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 4
AclWI GGATC 3 cut(s) 27, 102, 260
AcsI RAATTY 1 cut(s) 211
AfaI GTAC 1 cut(s) 55
AflII CTTAAG 1 cut(s) 176
Alw26I GTCTC 1 cut(s) 7
AlwI GGATC 3 cut(s) 27, 102, 260
ApoI RAATTY 1 cut(s) 211
AspS9I GGNCC 1 cut(s) 103
AsuHPI GGTGA 1 cut(s) 154
AvaII GGWCC 1 cut(s) 103
BaeI ACNNNNGTAYC 2 cut(s) 117, 150
BbsI GAAGAC 1 cut(s) 14
BcgI CGANNNNNNTGC 2 cut(s) 198, 232
BcoDI GTCTC 1 cut(s) 7
BfaI CTAG 1 cut(s) 29
BfrI CTTAAG 1 cut(s) 176
Bme18I GGWCC 1 cut(s) 103
BmgT120I GGNCC 1 cut(s) 103
BmiI GGNNCC 1 cut(s) 105
BpiI GAAGAC 1 cut(s) 14
BseMII CTCAG 1 cut(s) 269
BslFI GGGAC 1 cut(s) 89
BsmAI GTCTC 1 cut(s) 7
BsmFI GGGAC 1 cut(s) 89
Bsp143I GATC 4 cut(s) 19, 94, 200, 252
BspACI CCGC 1 cut(s) 4
BspCNI CTCAG 1 cut(s) 270
BspLI GGNNCC 1 cut(s) 105
BspPI GGATC 3 cut(s) 27, 102, 260
BspTI CTTAAG 1 cut(s) 176
BssMI GATC 4 cut(s) 19, 94, 200, 252
BstAFI CTTAAG 1 cut(s) 176
BstDEI CTNAG 1 cut(s) 278
BstKTI GATC 4 cut(s) 22, 97, 203, 255
BstMAI GTCTC 1 cut(s) 7
BstMBI GATC 4 cut(s) 19, 94, 200, 252
BstV2I GAAGAC 1 cut(s) 14
Cfr13I GGNCC 1 cut(s) 103
Csp6I GTAC 1 cut(s) 54
CviJI RGCY 2 cut(s) 175, 207
CviKI_1 RGCY 2 cut(s) 175, 207
CviQI GTAC 1 cut(s) 54
DdeI CTNAG 1 cut(s) 278
DpnI GATC 4 cut(s) 21, 96, 202, 254
DpnII GATC 4 cut(s) 19, 94, 200, 252
Eco32I GATATC 1 cut(s) 34
Eco47I GGWCC 1 cut(s) 103
EcoO109I RGGNCCY 1 cut(s) 103
EcoRV GATATC 1 cut(s) 34
FaiI YATR 6 cut(s) 38, 80, 242, 262, 268, 275
FaqI GGGAC 1 cut(s) 89
FspBI CTAG 1 cut(s) 29
HphI GGTGA 1 cut(s) 154
Hpy188I TCNGA 2 cut(s) 43, 151
Hpy188III TCNNGA 1 cut(s) 29
HpyAV CCTTC 2 cut(s) 38, 124
HpyCH4V TGCA 1 cut(s) 219
HpyF3I CTNAG 1 cut(s) 278
Kzo9I GATC 4 cut(s) 19, 94, 200, 252
LpnPI CCDG 3 cut(s) 2, 86, 233
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 142
MalI GATC 4 cut(s) 21, 96, 202, 254
MboI GATC 4 cut(s) 19, 94, 200, 252
MboII GAAGA 1 cut(s) 19
MluCI AATT 4 cut(s) 65, 111, 211, 243
MnlI CCTC 2 cut(s) 79, 165
MseI TTAA 3 cut(s) 110, 156, 177
MspCI CTTAAG 1 cut(s) 176
NdeII GATC 4 cut(s) 19, 94, 200, 252
NlaIV GGNNCC 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 142
PpuMI RGGWCCY 1 cut(s) 103
Psp5II RGGWCCY 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 105
PspPI GGNCC 1 cut(s) 103
PspPPI RGGWCCY 1 cut(s) 103
RsaI GTAC 1 cut(s) 55
RsaNI GTAC 1 cut(s) 54
SaqAI TTAA 3 cut(s) 110, 156, 177
Sau3AI GATC 4 cut(s) 19, 94, 200, 252
Sau96I GGNCC 1 cut(s) 103
SetI ASST 4 cut(s) 28, 105, 135, 144
SinI GGWCC 1 cut(s) 103
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 4 cut(s) 65, 111, 211, 243
SsiI CCGC 1 cut(s) 4
SspMI CTAG 1 cut(s) 29
TaqI TCGA 2 cut(s) 97, 203
TasI AATT 4 cut(s) 65, 111, 211, 243
Tru1I TTAA 3 cut(s) 110, 156, 177
Tru9I TTAA 3 cut(s) 110, 156, 177
TseFI GTSAC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 95
Vha464I CTTAAG 1 cut(s) 176
VpaK11BI GGWCC 1 cut(s) 103
XapI RAATTY 1 cut(s) 211
XbaI TCTAGA 1 cut(s) 28
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.