FvH4_4g10090

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Forward (+)
12798548 .. 12799094
547 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g10090.t1

Sequence Viewer

Length: 243 bp
ATGGCCAAAGTTCTGCAATTGCTCAGCTTACTTAACATCCTTATTCTTGTTGGTTCAGTTGAACCAAGAAAATTACAACAATGCCCTAGATTGGTGTTATATAATGTCTACTGTGCTCATTTGGGAACGGATCATATATGCACGGAACAATGTTCGAAGCAAGTTGATCCCCAGAGTTTGGCAATTTGTGAAAGCCCCCCAAATTTGACTATAATTCTATGCATGTGCATCTGTCCTTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.85

Weight (kDa)

6.67

Isoelectric Point (pI)

67.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019224)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 178
AccI GTMKAC 1 cut(s) 108
AclWI GGATC 2 cut(s) 138, 161
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 202
AfiI CCNNNNNNNGG 2 cut(s) 91, 178
AgsI TTSAA 1 cut(s) 62
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
Alw21I GWGCWC 1 cut(s) 118
AlwI GGATC 2 cut(s) 138, 161
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 202
AsuII TTCGAA 1 cut(s) 155
BalI TGGCCA 1 cut(s) 5
Bbv12I GWGCWC 1 cut(s) 118
BfaI CTAG 1 cut(s) 87
BlpI GCTNAGC 1 cut(s) 23
BmsI GCATC 1 cut(s) 237
Bpu1102I GCTNAGC 1 cut(s) 23
Bpu14I TTCGAA 1 cut(s) 155
Bsc4I CCNNNNNNNGG 2 cut(s) 91, 178
BseGI GGATG 1 cut(s) 36
BseLI CCNNNNNNNGG 2 cut(s) 91, 178
BseMII CTCAG 1 cut(s) 37
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 118
BslI CCNNNNNNNGG 2 cut(s) 91, 178
BsnI GGCC 1 cut(s) 5
Bsp119I TTCGAA 1 cut(s) 155
Bsp1286I GDGCHC 1 cut(s) 118
Bsp143I GATC 2 cut(s) 130, 166
Bsp1720I GCTNAGC 1 cut(s) 23
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 36
BspPI GGATC 2 cut(s) 138, 161
BspT104I TTCGAA 1 cut(s) 155
BssMI GATC 2 cut(s) 130, 166
Bst4CI ACNGT 1 cut(s) 113
BstBI TTCGAA 1 cut(s) 155
BstDEI CTNAG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 36
BstKTI GATC 2 cut(s) 133, 169
BstMBI GATC 2 cut(s) 130, 166
BstNSI RCATGY 1 cut(s) 226
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 36
CviAII CATG 1 cut(s) 223
CviJI RGCY 3 cut(s) 5, 27, 195
CviKI_1 RGCY 3 cut(s) 5, 27, 195
DdeI CTNAG 1 cut(s) 23
DpnI GATC 2 cut(s) 132, 168
DpnII GATC 2 cut(s) 130, 166
EaeI YGGCCR 1 cut(s) 3
EcoT22I ATGCAT 1 cut(s) 224
FaeI CATG 1 cut(s) 226
FaiI YATR 8 cut(s) 100, 102, 135, 137, 139, 212, 220, 224
FatI CATG 1 cut(s) 222
FblI GTMKAC 1 cut(s) 108
FokI GGATG 1 cut(s) 23
FspBI CTAG 1 cut(s) 87
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 226
Hpy166II GTNNAC 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 109
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 4 cut(s) 16, 141, 222, 228
HpyF3I CTNAG 1 cut(s) 23
Hsp92II CATG 1 cut(s) 226
Kzo9I GATC 2 cut(s) 130, 166
LpnPI CCDG 1 cut(s) 185
LweI GCATC 1 cut(s) 237
MaeI CTAG 1 cut(s) 87
MalI GATC 2 cut(s) 132, 168
MboI GATC 2 cut(s) 130, 166
MfeI CAATTG 1 cut(s) 17
MhlI GDGCHC 1 cut(s) 118
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 5 cut(s) 17, 71, 183, 202, 213
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 224
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 33
Msp20I TGGCCA 1 cut(s) 5
MunI CAATTG 1 cut(s) 17
NdeII GATC 2 cut(s) 130, 166
NlaIII CATG 1 cut(s) 226
NsiI ATGCAT 1 cut(s) 224
NspI RCATGY 1 cut(s) 226
NspV TTCGAA 1 cut(s) 155
PflMI CCANNNNNTGG 1 cut(s) 178
SaqAI TTAA 1 cut(s) 33
Sau3AI GATC 2 cut(s) 130, 166
SduI GDGCHC 1 cut(s) 118
SetI ASST 1 cut(s) 29
SfaNI GCATC 1 cut(s) 237
SfuI TTCGAA 1 cut(s) 155
SgeI CNNG 7 cut(s) 59, 78, 99, 154, 173, 184, 235
Sse9I AATT 5 cut(s) 17, 71, 183, 202, 213
SspMI CTAG 1 cut(s) 87
TaaI ACNGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 155
TasI AATT 5 cut(s) 17, 71, 183, 202, 213
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TspGWI ACGGA 2 cut(s) 143, 158
Van91I CCANNNNNTGG 1 cut(s) 178
XapI RAATTY 1 cut(s) 202
XceI RCATGY 1 cut(s) 226
XmiI GTMKAC 1 cut(s) 108
XspI CTAG 1 cut(s) 87
Zsp2I ATGCAT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.