FvH4_4g16650

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Reverse (-)
20509571 .. 20510400
830 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g16650.t1

Sequence Viewer

Length: 273 bp
ATGGGGGAGAAACTCAGCAAGATGACCCGACCCGAAACCCAGGCAGAACCAAAACCCAGTGACCAGTCCAAGCCGCCACCGCCGCCTCTGCATTCGGAGGTAGAAGACGACGATGAGAATGTCAAACAGCTCCAGGAGTGTTCTGCTCTCTATCTTTCCTTACAGGATTGCCTTATCAAGAATGATAGGAATTGGAAATCTTGTCAATTGGAAGTTCAAGCCTTGAAGCAATGCAATGAGAGGAAGAAGAAGAATGTTGAGAAAGAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.41

Weight (kDa)

5.86

Isoelectric Point (pI)

57.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 74, 80, 83
AgsI TTSAA 2 cut(s) 218, 226
AjnI CCWGG 2 cut(s) 39, 132
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
BbsI GAAGAC 1 cut(s) 111
BciT130I CCWGG 2 cut(s) 41, 134
BisI GCNGC 2 cut(s) 74, 83
BlsI GCNGC 2 cut(s) 75, 84
Bme1390I CCNGG 2 cut(s) 41, 134
BmrFI CCNGG 2 cut(s) 41, 134
BmrI ACTGGG 1 cut(s) 51
BmuI ACTGGG 1 cut(s) 51
BpiI GAAGAC 1 cut(s) 111
BpmI CTGGAG 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 39
Bse1I ACTGG 2 cut(s) 57, 64
Bse3DI GCAATG 2 cut(s) 236, 241
BseBI CCWGG 2 cut(s) 41, 134
BseDI CCNNGG 1 cut(s) 39
BseMI GCAATG 2 cut(s) 236, 241
BseMII CTCAG 1 cut(s) 28
BseNI ACTGG 2 cut(s) 57, 64
BsmI GAATGC 1 cut(s) 91
BspACI CCGC 3 cut(s) 74, 80, 83
BspCNI CTCAG 1 cut(s) 27
BsrDI GCAATG 2 cut(s) 236, 241
BsrI ACTGG 2 cut(s) 57, 64
BssECI CCNNGG 1 cut(s) 39
Bst2UI CCWGG 2 cut(s) 41, 134
BstDEI CTNAG 1 cut(s) 14
BstMWI GCNNNNNNNGC 3 cut(s) 79, 82, 88
BstNI CCWGG 2 cut(s) 41, 134
BstSCI CCNGG 2 cut(s) 39, 132
BstV2I GAAGAC 1 cut(s) 111
BtsIMutI CAGTG 1 cut(s) 64
CviJI RGCY 3 cut(s) 73, 130, 221
CviKI_1 RGCY 3 cut(s) 73, 130, 221
DdeI CTNAG 1 cut(s) 14
EcoRII CCWGG 2 cut(s) 39, 132
Fnu4HI GCNGC 2 cut(s) 74, 83
Fsp4HI GCNGC 2 cut(s) 74, 83
GluI GCNGC 2 cut(s) 74, 83
GsuI CTGGAG 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 178
Hpy99I CGWCG 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 91, 234
HpyF10VI GCNNNNNNNGC 3 cut(s) 79, 82, 88
HpyF3I CTNAG 1 cut(s) 14
LmnI GCTCC 1 cut(s) 135
LpnPI CCDG 7 cut(s) 26, 53, 70, 77, 119, 146, 149
MaeIII GTNAC 1 cut(s) 59
MboII GAAGA 4 cut(s) 116, 256, 259, 262
MfeI CAATTG 1 cut(s) 206
MluCI AATT 2 cut(s) 190, 206
MnlI CCTC 3 cut(s) 91, 96, 234
MspR9I CCNGG 2 cut(s) 41, 134
MunI CAATTG 1 cut(s) 206
Mva1269I GAATGC 1 cut(s) 91
MvaI CCWGG 2 cut(s) 41, 134
MwoI GCNNNNNNNGC 3 cut(s) 79, 82, 88
NmuCI GTSAC 1 cut(s) 59
PctI GAATGC 1 cut(s) 91
PfoI TCCNGGA 1 cut(s) 132
PkrI GCNGC 2 cut(s) 75, 84
Psp6I CCWGG 2 cut(s) 39, 132
PspGI CCWGG 2 cut(s) 39, 132
SatI GCNGC 2 cut(s) 74, 83
ScrFI CCNGG 2 cut(s) 41, 134
SetI ASST 2 cut(s) 102, 132
Sse9I AATT 2 cut(s) 190, 206
SsiI CCGC 3 cut(s) 74, 80, 83
StyD4I CCNGG 2 cut(s) 39, 132
TasI AATT 2 cut(s) 190, 206
TauI GCSGC 2 cut(s) 76, 85
TscAI CASTG 1 cut(s) 64
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
TspRI CASTG 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.