Rmu_sc0006133.1_g000012

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006133.1
Physical Location & Seq
Forward (+)
28952 .. 29420
469 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006133.1_g000012.1.cds

Sequence Viewer

Length: 273 bp
atgggagagaaactcagcaagatgacccgacccgacccccaggcagaaccaaaacccagtgaccagtcgcagccgccacccccgcctctccattcggaggtggaagacgacgatgagaacgtgaagcagctcaaggagtgttctgctctctatctttccttacaggattgccttatcaagaatgataggaattggaaatcttgtcaattggaagttcaagccttgaagcaatgcaatgagaggaagcagatgaagaatgacaaagaaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.41

Weight (kDa)

5.41

Isoelectric Point (pI)

58.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 74, 83
AfiI CCNNNNNNNGG 1 cut(s) 97
AgsI TTSAA 2 cut(s) 218, 226
AjnI CCWGG 1 cut(s) 39
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
ApeKI GCWGC 2 cut(s) 70, 127
BbsI GAAGAC 1 cut(s) 111
BbvI GCAGC 2 cut(s) 82, 139
BciT130I CCWGG 1 cut(s) 41
BisI GCNGC 3 cut(s) 71, 74, 128
BlsI GCNGC 3 cut(s) 72, 75, 129
Bme1390I CCNGG 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 41
BmrI ACTGGG 1 cut(s) 51
BmuI ACTGGG 1 cut(s) 51
BpiI GAAGAC 1 cut(s) 111
BplI GAGNNNNNCTC 1 cut(s) 29
BpuEI CTTGAG 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 39
Bsc4I CCNNNNNNNGG 1 cut(s) 97
Bse1I ACTGG 2 cut(s) 57, 64
Bse3DI GCAATG 2 cut(s) 236, 241
BseBI CCWGG 1 cut(s) 41
BseDI CCNNGG 1 cut(s) 39
BseLI CCNNNNNNNGG 1 cut(s) 97
BseMI GCAATG 2 cut(s) 236, 241
BseMII CTCAG 1 cut(s) 28
BseNI ACTGG 2 cut(s) 57, 64
BseXI GCAGC 2 cut(s) 82, 139
BslI CCNNNNNNNGG 1 cut(s) 97
BspACI CCGC 2 cut(s) 74, 83
BspCNI CTCAG 1 cut(s) 27
BsrDI GCAATG 2 cut(s) 236, 241
BsrI ACTGG 2 cut(s) 57, 64
BssECI CCNNGG 1 cut(s) 39
Bst2UI CCWGG 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 14
BstMWI GCNNNNNNNGC 1 cut(s) 82
BstNI CCWGG 1 cut(s) 41
BstSCI CCNGG 1 cut(s) 39
BstV1I GCAGC 2 cut(s) 82, 139
BstV2I GAAGAC 1 cut(s) 111
BtsIMutI CAGTG 1 cut(s) 64
CviJI RGCY 3 cut(s) 73, 130, 221
CviKI_1 RGCY 3 cut(s) 73, 130, 221
DdeI CTNAG 1 cut(s) 14
EcoRII CCWGG 1 cut(s) 39
FauI CCCGC 1 cut(s) 90
Fnu4HI GCNGC 3 cut(s) 71, 74, 128
Fsp4HI GCNGC 3 cut(s) 71, 74, 128
GluI GCNGC 3 cut(s) 71, 74, 128
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 178
Hpy99I CGWCG 1 cut(s) 113
HpyCH4IV ACGT 1 cut(s) 120
HpyCH4V TGCA 1 cut(s) 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 82
HpyF3I CTNAG 1 cut(s) 14
HpySE526I ACGT 1 cut(s) 120
LpnPI CCDG 5 cut(s) 26, 53, 70, 77, 149
Lsp1109I GCAGC 2 cut(s) 82, 139
MaeII ACGT 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 59
MboII GAAGA 2 cut(s) 116, 265
MfeI CAATTG 1 cut(s) 206
MluCI AATT 2 cut(s) 190, 206
MnlI CCTC 3 cut(s) 91, 96, 234
MspR9I CCNGG 1 cut(s) 41
MunI CAATTG 1 cut(s) 206
MvaI CCWGG 1 cut(s) 41
MwoI GCNNNNNNNGC 1 cut(s) 82
NmuCI GTSAC 1 cut(s) 59
PcsI WCGNNNNNNNCGW 1 cut(s) 117
PkrI GCNGC 3 cut(s) 72, 75, 129
Psp6I CCWGG 1 cut(s) 39
PspGI CCWGG 1 cut(s) 39
SatI GCNGC 3 cut(s) 71, 74, 128
ScrFI CCNGG 1 cut(s) 41
SetI ASST 3 cut(s) 102, 123, 132
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 2 cut(s) 190, 206
SsiI CCGC 2 cut(s) 74, 83
StyD4I CCNGG 1 cut(s) 39
TaiI ACGT 1 cut(s) 123
TasI AATT 2 cut(s) 190, 206
TauI GCSGC 1 cut(s) 76
TscAI CASTG 1 cut(s) 64
TseFI GTSAC 1 cut(s) 59
TseI GCWGC 2 cut(s) 70, 127
Tsp45I GTSAC 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 266
TspRI CASTG 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.