Rorug04G0162200

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
28253555 .. 28254112
558 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0162200.1

Sequence Viewer

Length: 219 bp
ATGAGAGGAGAAGTTGAAGCAATCTTCTTAAAGCACAATGTAATTGATGAGTATGATGAACAATCCGAGGTTGCAGACTGGATTAGAATTAAGACGGTCCCCCTCTTCCATTTCTATAAAGATGGTGTTCTCTTGGAAGCATTCCTAATTAGACACGAGGAGAGGATCACTGTGGCAATTCGTAAATACACATCTCCTGCAACATCTGAATTGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.49

Weight (kDa)

5.25

Isoelectric Point (pI)

44.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 173
AgsI TTSAA 1 cut(s) 17
AlwI GGATC 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 97
AvaII GGWCC 1 cut(s) 97
BauI CACGAG 1 cut(s) 155
BccI CCATC 1 cut(s) 116
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 66
Bse1I ACTGG 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 66
BseNI ACTGG 1 cut(s) 83
BseRI GAGGAG 2 cut(s) 21, 173
BslFI GGGAC 1 cut(s) 83
BsmFI GGGAC 1 cut(s) 83
BsmI GAATGC 1 cut(s) 140
Bsp143I GATC 1 cut(s) 165
BspLI GGNNCC 1 cut(s) 99
BspPI GGATC 1 cut(s) 173
BsrI ACTGG 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 66
BssMI GATC 1 cut(s) 165
BssSI CACGAG 1 cut(s) 155
Bst2BI CACGAG 1 cut(s) 155
Bst4CI ACNGT 2 cut(s) 97, 172
Bst6I CTCTTC 1 cut(s) 110
BstKTI GATC 1 cut(s) 168
BstMBI GATC 1 cut(s) 165
BtsIMutI CAGTG 1 cut(s) 168
Cfr13I GGNCC 1 cut(s) 97
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
Eam1104I CTCTTC 1 cut(s) 110
EarI CTCTTC 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 97
FaiI YATR 2 cut(s) 54, 117
FaqI GGGAC 1 cut(s) 83
Hpy188I TCNGA 2 cut(s) 67, 208
HpyCH4III ACNGT 2 cut(s) 97, 172
HpyCH4V TGCA 2 cut(s) 74, 200
Kzo9I GATC 1 cut(s) 165
LpnPI CCDG 2 cut(s) 64, 210
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MboII GAAGA 2 cut(s) 16, 97
MluCI AATT 5 cut(s) 42, 87, 147, 177, 209
MnlI CCTC 4 cut(s) 61, 113, 151, 156
MseI TTAA 2 cut(s) 29, 90
Mva1269I GAATGC 1 cut(s) 140
NdeII GATC 1 cut(s) 165
NlaIV GGNNCC 1 cut(s) 99
PctI GAATGC 1 cut(s) 140
PspN4I GGNNCC 1 cut(s) 99
PspPI GGNCC 1 cut(s) 97
SaqAI TTAA 2 cut(s) 29, 90
Sau3AI GATC 1 cut(s) 165
Sau96I GGNCC 1 cut(s) 97
SetI ASST 1 cut(s) 72
SgeI CNNG 6 cut(s) 79, 91, 145, 167, 169, 209
SinI GGWCC 1 cut(s) 97
Sse9I AATT 5 cut(s) 42, 87, 147, 177, 209
TaaI ACNGT 2 cut(s) 97, 172
TasI AATT 5 cut(s) 42, 87, 147, 177, 209
Tru1I TTAA 2 cut(s) 29, 90
Tru9I TTAA 2 cut(s) 29, 90
TscAI CASTG 1 cut(s) 175
TspDTI ATGAA 1 cut(s) 72
TspRI CASTG 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.