FvH4_4g28750

Phytosulfokine precursor protein (PSK)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0018026
Physical Location & Seq
Forward (+)
29261572 .. 29262471
900 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g28750.t1

Sequence Viewer

Length: 294 bp
ATGGCAAATATTGGCCTTAGTTTCTTCGTTCTGGTTTTACTTCTACTTTCAAAGGTGGAAGCCAGACCAATGCCTGCAACCCCCGTTTTGCCTCTATCTGATCCAATTCTGTCATCTTCTTCAACTTCCATAACATCCTCATCACCTGCTAGTGGAGCAAGCTTGAGTGATATCTATGATGATGATGATGCTTGCAAGGGCTTAAAAAGCGAGGAATGTTTGATGAGAAGGTCGATGGTTGCTCACACAGATTATATATACACACAGGATATCAGCACTAGTACTGAGCCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PSK

Protein Analysis

98

Amino Acids

10.36

Weight (kDa)

4.35

Isoelectric Point (pI)

73.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSK PF06404 11 - 90 4.8e-13 Phytosulfokine precursor protein (PSK)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018026)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g28750 FvH4_6g32510
malus_domestica MD13G1053700.v1.1
prunus_persica Prupe.1G298400_v2.0.a1
rosa_multiflora Rmu_sc0001464.1_g000019
rosa_roxburghii Rroxscaffold_5G00377940
rosa_rugosa Rorug04G0296900
rosa_samantha Rh4AG351200 Rh4BG360200 Rh4CG374500 Rh4DG354500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 154
Acc36I ACCTGC 1 cut(s) 154
AclWI GGATC 1 cut(s) 95
AfaI GTAC 1 cut(s) 283
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 2 cut(s) 51, 123
AhlI ACTAGT 1 cut(s) 278
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
AlwI GGATC 1 cut(s) 95
AoxI GGCC 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 135
BccI CCATC 1 cut(s) 229
BceAI ACGGC 1 cut(s) 274
BcuI ACTAGT 1 cut(s) 278
BfaI CTAG 2 cut(s) 150, 279
BfuAI ACCTGC 1 cut(s) 154
BmcAI AGTACT 1 cut(s) 283
BmsI GCATC 1 cut(s) 178
BpuEI CTTGAG 1 cut(s) 184
Bsc4I CCNNNNNNNGG 1 cut(s) 152
BseGI GGATG 1 cut(s) 134
BseLI CCNNNNNNNGG 1 cut(s) 152
BseMII CTCAG 1 cut(s) 276
BshFI GGCC 1 cut(s) 15
BslI CCNNNNNNNGG 1 cut(s) 152
BsnI GGCC 1 cut(s) 15
Bsp143I GATC 1 cut(s) 100
BspANI GGCC 1 cut(s) 15
BspCNI CTCAG 1 cut(s) 277
BspMI ACCTGC 1 cut(s) 154
BspPI GGATC 1 cut(s) 95
BssMI GATC 1 cut(s) 100
BstC8I GCNNGC 3 cut(s) 75, 160, 193
BstDEI CTNAG 2 cut(s) 17, 285
BstF5I GGATG 1 cut(s) 134
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BstMWI GCNNNNNNNGC 2 cut(s) 155, 207
BsuRI GGCC 1 cut(s) 15
BtsCI GGATG 1 cut(s) 134
BveI ACCTGC 1 cut(s) 154
Cac8I GCNNGC 3 cut(s) 75, 160, 193
Csp6I GTAC 1 cut(s) 282
CviJI RGCY 5 cut(s) 15, 62, 162, 201, 289
CviKI_1 RGCY 5 cut(s) 15, 62, 162, 201, 289
CviQI GTAC 1 cut(s) 282
DdeI CTNAG 2 cut(s) 17, 285
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
Eco32I GATATC 2 cut(s) 172, 271
EcoRV GATATC 2 cut(s) 172, 271
FaiI YATR 5 cut(s) 131, 177, 255, 257, 259
FokI GGATG 1 cut(s) 121
FspBI CTAG 2 cut(s) 150, 279
HaeIII GGCC 1 cut(s) 15
HindIII AAGCTT 1 cut(s) 160
HphI GGTGA 1 cut(s) 135
Hpy188I TCNGA 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 222
HpyCH4V TGCA 2 cut(s) 77, 195
HpyF10VI GCNNNNNNNGC 2 cut(s) 155, 207
HpyF3I CTNAG 2 cut(s) 17, 285
Kzo9I GATC 1 cut(s) 100
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 5 cut(s) 17, 76, 87, 159, 251
LweI GCATC 1 cut(s) 178
MaeI CTAG 2 cut(s) 150, 279
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MboII GAAGA 3 cut(s) 16, 108, 111
MluCI AATT 1 cut(s) 105
MnlI CCTC 3 cut(s) 102, 148, 205
MseI TTAA 1 cut(s) 203
MwoI GCNNNNNNNGC 2 cut(s) 155, 207
NdeII GATC 1 cut(s) 100
PaqCI CACCTGC 1 cut(s) 154
RsaI GTAC 1 cut(s) 283
RsaNI GTAC 1 cut(s) 282
SaqAI TTAA 1 cut(s) 203
Sau3AI GATC 1 cut(s) 100
ScaI AGTACT 1 cut(s) 283
SetI ASST 4 cut(s) 57, 148, 164, 233
SfaNI GCATC 1 cut(s) 178
SmlI CTYRAG 1 cut(s) 163
SmoI CTYRAG 1 cut(s) 163
SpeI ACTAGT 1 cut(s) 278
Sse9I AATT 1 cut(s) 105
SspI AATATT 1 cut(s) 10
SspMI CTAG 2 cut(s) 150, 279
TaqI TCGA 1 cut(s) 233
TasI AATT 1 cut(s) 105
TatI WGTACW 1 cut(s) 281
Tru1I TTAA 1 cut(s) 203
Tru9I TTAA 1 cut(s) 203
XspI CTAG 2 cut(s) 150, 279
ZrmI AGTACT 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.