Rroxscaffold_5G00377940

Phytosulfokine precursor protein (PSK)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0018026
Physical Location & Seq
Forward (+)
58469532 .. 58469999
468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00377940.1

Sequence Viewer

Length: 219 bp
ATGCCTGCAGCTCCCATTTTGCCTCTATCTGATCCAAATTTTTCATCTTCTTCCATTTCCATAACATCATCATCACCTAATGGAGCAAGCCTGAGTGATATTGATGATGATGATGCTTGGAAGGGTTTAAACAGCAAGGACTGTTTGATGAGAAGGTCGATGGTTGCCCACACAGATTACATCTACACACAGGATATCAGCACTAGTACTGAACCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PSK

Protein Analysis

72

Amino Acids

7.72

Weight (kDa)

4.12

Isoelectric Point (pI)

58.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSK PF06404 41 - 65 1.2e-09 Phytosulfokine precursor protein (PSK)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018026)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g28750 FvH4_6g32510
malus_domestica MD13G1053700.v1.1
prunus_persica Prupe.1G298400_v2.0.a1
rosa_multiflora Rmu_sc0001464.1_g000019
rosa_roxburghii Rroxscaffold_5G00377940
rosa_rugosa Rorug04G0296900
rosa_samantha Rh4AG351200 Rh4BG360200 Rh4CG374500 Rh4DG354500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 26
AcsI RAATTY 1 cut(s) 37
AfaI GTAC 1 cut(s) 208
AhlI ACTAGT 1 cut(s) 203
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
AlwI GGATC 1 cut(s) 26
ApeKI GCWGC 1 cut(s) 8
ApoI RAATTY 1 cut(s) 37
AsuHPI GGTGA 1 cut(s) 66
BbvI GCAGC 1 cut(s) 20
BccI CCATC 1 cut(s) 154
BcuI ACTAGT 1 cut(s) 203
BfaI CTAG 1 cut(s) 204
BfmI CTRYAG 1 cut(s) 6
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
BmcAI AGTACT 1 cut(s) 208
BmsI GCATC 1 cut(s) 103
BseMII CTCAG 1 cut(s) 83
BseXI GCAGC 1 cut(s) 20
Bsp143I GATC 1 cut(s) 31
BspCNI CTCAG 1 cut(s) 84
BspMAI CTGCAG 1 cut(s) 10
BspPI GGATC 1 cut(s) 26
BssMI GATC 1 cut(s) 31
Bst4CI ACNGT 1 cut(s) 143
BstC8I GCNNGC 2 cut(s) 6, 88
BstDEI CTNAG 1 cut(s) 92
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstSFI CTRYAG 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 20
Cac8I GCNNGC 2 cut(s) 6, 88
Csp6I GTAC 1 cut(s) 207
CviJI RGCY 2 cut(s) 11, 90
CviKI_1 RGCY 2 cut(s) 11, 90
CviQI GTAC 1 cut(s) 207
DdeI CTNAG 1 cut(s) 92
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
DraI TTTAAA 1 cut(s) 129
Eco32I GATATC 1 cut(s) 196
EcoRV GATATC 1 cut(s) 196
FaiI YATR 1 cut(s) 62
Fnu4HI GCNGC 1 cut(s) 9
Fsp4HI GCNGC 1 cut(s) 9
FspBI CTAG 1 cut(s) 204
GluI GCNGC 1 cut(s) 9
HphI GGTGA 1 cut(s) 66
Hpy188I TCNGA 1 cut(s) 31
HpyAV CCTTC 2 cut(s) 115, 147
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 92
Kzo9I GATC 1 cut(s) 31
LmnI GCTCC 2 cut(s) 16, 83
LpnPI CCDG 3 cut(s) 18, 104, 176
Lsp1109I GCAGC 1 cut(s) 20
LweI GCATC 1 cut(s) 103
MaeI CTAG 1 cut(s) 204
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 2 cut(s) 39, 42
MluCI AATT 1 cut(s) 37
MnlI CCTC 1 cut(s) 33
MseI TTAA 1 cut(s) 128
MssI GTTTAAAC 1 cut(s) 129
NdeII GATC 1 cut(s) 31
PkrI GCNGC 1 cut(s) 10
PmeI GTTTAAAC 1 cut(s) 129
PstI CTGCAG 1 cut(s) 10
RsaI GTAC 1 cut(s) 208
RsaNI GTAC 1 cut(s) 207
SaqAI TTAA 1 cut(s) 128
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 1 cut(s) 31
ScaI AGTACT 1 cut(s) 208
SetI ASST 4 cut(s) 13, 79, 158, 217
SfaNI GCATC 1 cut(s) 103
SfcI CTRYAG 1 cut(s) 6
SgeI CNNG 6 cut(s) 17, 99, 103, 129, 148, 203
SpeI ACTAGT 1 cut(s) 203
Sse9I AATT 1 cut(s) 37
SspMI CTAG 1 cut(s) 204
TaaI ACNGT 1 cut(s) 143
TaqI TCGA 1 cut(s) 158
TasI AATT 1 cut(s) 37
TatI WGTACW 1 cut(s) 206
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TseI GCWGC 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 33
XapI RAATTY 1 cut(s) 37
XspI CTAG 1 cut(s) 204
ZrmI AGTACT 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.