Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb6

Orthogroup ID

OG0018026

Physical Location & Seq

Genomic Coordinates Reverse (-)

25573097 .. 25573469

Gene Structure 373 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_6g32510.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 198 bp

ATGGAACACAAAGGCCTCTTTTTCTTCACATTTCTCGGCACAGATGCCTTCCTAGCTCCCTTTTCCAGCAGCTTCAGTGGAGCAAGCTTGAGTGATAATGATGATGATGAAGCTTGCAAGGGCTTAAAAAGCGAGGAATGTTTGAGGAGAAGGTCGATGGTTGCTCACACAGATTATATATACACACAGCACTTGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PSK

Protein Analysis

66

Amino Acids

7.34

Weight (kDa)

5.07

Isoelectric Point (pI)

66.43

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PSK	PF06404	32 - 64	3.8e-13	Phytosulfokine precursor protein (PSK)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018026)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g28750 FvH4_6g32510
malus_domestica	MD13G1053700.v1.1
prunus_persica	Prupe.1G298400_v2.0.a1
rosa_multiflora	Rmu_sc0001464.1_g000019
rosa_roxburghii	Rroxscaffold_5G00377940
rosa_rugosa	Rorug04G0296900
rosa_samantha	Rh4AG351200 Rh4BG360200 Rh4CG374500 Rh4DG354500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	58
AluBI	AGCT	4 cut(s)	56, 72, 87, 113
AluI	AGCT	4 cut(s)	56, 72, 87, 113
AoxI	GGCC	1 cut(s)	13
ApeKI	GCWGC	1 cut(s)	69
BbvI	GCAGC	1 cut(s)	81
BccI	CCATC	1 cut(s)	151
BfaI	CTAG	1 cut(s)	53
BisI	GCNGC	1 cut(s)	70
BlsI	GCNGC	1 cut(s)	71
BmsI	GCATC	1 cut(s)	34
BpuEI	CTTGAG	1 cut(s)	109
BseRI	GAGGAG	1 cut(s)	160
BseXI	GCAGC	1 cut(s)	81
BshFI	GGCC	1 cut(s)	15
BsnI	GGCC	1 cut(s)	15
BspANI	GGCC	1 cut(s)	15
BstC8I	GCNNGC	2 cut(s)	85, 115
BstMWI	GCNNNNNNNGC	2 cut(s)	53, 129
BstV1I	GCAGC	1 cut(s)	81
BsuRI	GGCC	1 cut(s)	15
BtsIMutI	CAGTG	1 cut(s)	82
Cac8I	GCNNGC	2 cut(s)	85, 115
CviJI	RGCY	6 cut(s)	15, 56, 72, 87, 113, 123
CviKI_1	RGCY	6 cut(s)	15, 56, 72, 87, 113, 123
Eco147I	AGGCCT	1 cut(s)	15
Eco57I	CTGAAG	1 cut(s)	58
FaiI	YATR	3 cut(s)	177, 179, 181
Fnu4HI	GCNGC	1 cut(s)	70
Fsp4HI	GCNGC	1 cut(s)	70
FspBI	CTAG	1 cut(s)	53
GluI	GCNGC	1 cut(s)	70
HaeIII	GGCC	1 cut(s)	15
HindIII	AAGCTT	2 cut(s)	85, 111
HpyAV	CCTTC	2 cut(s)	58, 144
HpyCH4V	TGCA	1 cut(s)	117
HpyF10VI	GCNNNNNNNGC	2 cut(s)	53, 129
LmnI	GCTCC	2 cut(s)	61, 80
LpnPI	CCDG	1 cut(s)	79
Lsp1109I	GCAGC	1 cut(s)	81
LweI	GCATC	1 cut(s)	34
MaeI	CTAG	1 cut(s)	53
MboII	GAAGA	1 cut(s)	16
MnlI	CCTC	3 cut(s)	26, 127, 138
MseI	TTAA	1 cut(s)	125
MwoI	GCNNNNNNNGC	2 cut(s)	53, 129
NmeAIII	GCCGAG	1 cut(s)	15
PceI	AGGCCT	1 cut(s)	15
PkrI	GCNGC	1 cut(s)	71
SaqAI	TTAA	1 cut(s)	125
SatI	GCNGC	1 cut(s)	70
SetI	ASST	5 cut(s)	58, 74, 89, 115, 155
SfaNI	GCATC	1 cut(s)	34
SgeI	CNNG	8 cut(s)	47, 65, 78, 96, 100, 126, 130, 145
SmlI	CTYRAG	1 cut(s)	88
SmoI	CTYRAG	1 cut(s)	88
SseBI	AGGCCT	1 cut(s)	15
SspMI	CTAG	1 cut(s)	53
StuI	AGGCCT	1 cut(s)	15
TaqI	TCGA	1 cut(s)	155
Tru1I	TTAA	1 cut(s)	125
Tru9I	TTAA	1 cut(s)	125
TscAI	CASTG	1 cut(s)	82
TseI	GCWGC	1 cut(s)	69
TspDTI	ATGAA	1 cut(s)	123
TspRI	CASTG	1 cut(s)	82
XspI	CTAG	1 cut(s)	53

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.