FvH4_5g03030

SPIRAL1-like 5

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
1817665 .. 1819485
1821 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g03030.t1

Sequence Viewer

Length: 300 bp
ATGAGTAGAGGTGGAAGCTATGGCGGTGGACAAAGTTCTTTGGGTTATTTGTTTGGTTCAGAGGAGCCACAAACTCCACCTCCAGCTGCTAAGCCAGTATTGCCGCCGTACGGCATCGACACCACCACCACCTATGATCATCACAAGCCTTCAGATCATAAGACTCCTTCCAATACCAACAACTATCAAAGAGCTGACGGCCCAAATTCTGGAAACTTCGTAACTGATCGTCCGACGACAAAAGTTAAATCAGTTCCTGGCGGAGATTCATCACTTGGTTACTTGTTTGGAGATAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

10.46

Weight (kDa)

6.82

Isoelectric Point (pI)

49.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013065)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 209
AciI CCGC 3 cut(s) 24, 104, 261
AcsI RAATTY 1 cut(s) 205
AcuI CTGAAG 1 cut(s) 135
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 2 cut(s) 110, 209
AjnI CCWGG 1 cut(s) 256
AluBI AGCT 3 cut(s) 18, 86, 194
AluI AGCT 3 cut(s) 18, 86, 194
AlwNI CAGNNNCTG 1 cut(s) 257
AoxI GGCC 1 cut(s) 199
ApeKI GCWGC 1 cut(s) 86
ApoI RAATTY 1 cut(s) 205
AspS9I GGNCC 1 cut(s) 200
BbvI GCAGC 1 cut(s) 73
BceAI ACGGC 3 cut(s) 91, 127, 214
BciT130I CCWGG 1 cut(s) 258
BclI TGATCA 1 cut(s) 136
BisI GCNGC 2 cut(s) 87, 104
BlpI GCTNAGC 1 cut(s) 90
BlsI GCNGC 2 cut(s) 88, 105
Bme1390I CCNGG 1 cut(s) 258
BmgT120I GGNCC 1 cut(s) 200
BmiI GGNNCC 1 cut(s) 66
BmrFI CCNGG 1 cut(s) 258
BmsI GCATC 1 cut(s) 123
BpmI CTGGAG 1 cut(s) 66
Bpu1102I GCTNAGC 1 cut(s) 90
BsaXI ACNNNNNCTCC 2 cut(s) 64, 94
Bsc4I CCNNNNNNNGG 2 cut(s) 110, 209
Bse1I ACTGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 258
BseLI CCNNNNNNNGG 2 cut(s) 110, 209
BseNI ACTGG 1 cut(s) 95
BseRI GAGGAG 1 cut(s) 77
BseXI GCAGC 1 cut(s) 73
BshFI GGCC 1 cut(s) 201
BsiWI CGTACG 1 cut(s) 108
BslI CCNNNNNNNGG 2 cut(s) 110, 209
BsnI GGCC 1 cut(s) 201
Bsp143I GATC 3 cut(s) 136, 154, 226
Bsp1720I GCTNAGC 1 cut(s) 90
BspACI CCGC 3 cut(s) 24, 104, 261
BspANI GGCC 1 cut(s) 201
BspLI GGNNCC 1 cut(s) 66
BsrI ACTGG 1 cut(s) 95
BssMI GATC 3 cut(s) 136, 154, 226
Bst2UI CCWGG 1 cut(s) 258
BstDEI CTNAG 1 cut(s) 90
BstKTI GATC 3 cut(s) 139, 157, 229
BstMBI GATC 3 cut(s) 136, 154, 226
BstMWI GCNNNNNNNGC 1 cut(s) 100
BstNI CCWGG 1 cut(s) 258
BstSCI CCNGG 1 cut(s) 256
BstV1I GCAGC 1 cut(s) 73
BsuRI GGCC 1 cut(s) 201
CaiI CAGNNNCTG 1 cut(s) 257
Cfr13I GGNCC 1 cut(s) 200
Csp6I GTAC 1 cut(s) 109
CviJI RGCY 7 cut(s) 18, 67, 86, 94, 148, 194, 201
CviKI_1 RGCY 7 cut(s) 18, 67, 86, 94, 148, 194, 201
CviQI GTAC 1 cut(s) 109
DdeI CTNAG 1 cut(s) 90
DpnI GATC 3 cut(s) 138, 156, 228
DpnII GATC 3 cut(s) 136, 154, 226
EciI GGCGGA 1 cut(s) 276
Eco57I CTGAAG 1 cut(s) 135
EcoRII CCWGG 1 cut(s) 256
FaiI YATR 3 cut(s) 21, 135, 159
FbaI TGATCA 1 cut(s) 136
Fnu4HI GCNGC 2 cut(s) 87, 104
Fsp4HI GCNGC 2 cut(s) 87, 104
GluI GCNGC 2 cut(s) 87, 104
GsuI CTGGAG 1 cut(s) 66
HaeIII GGCC 1 cut(s) 201
HinfI GANTC 2 cut(s) 163, 266
Hpy166II GTNNAC 1 cut(s) 29
Hpy188I TCNGA 3 cut(s) 61, 154, 234
Hpy188III TCNNGA 1 cut(s) 210
Hpy8I GTNNAC 1 cut(s) 29
Hpy99I CGWCG 1 cut(s) 238
HpyAV CCTTC 2 cut(s) 159, 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 100
HpyF3I CTNAG 1 cut(s) 90
Ksp22I TGATCA 1 cut(s) 136
Kzo9I GATC 3 cut(s) 136, 154, 226
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 5 cut(s) 96, 108, 195, 243, 270
Lsp1109I GCAGC 1 cut(s) 73
LweI GCATC 1 cut(s) 123
MaeIII GTNAC 2 cut(s) 220, 278
MalI GATC 3 cut(s) 138, 156, 228
MboI GATC 3 cut(s) 136, 154, 226
MluCI AATT 1 cut(s) 205
MlyI GAGTC 1 cut(s) 157
MmeI TCCRAC 1 cut(s) 257
MnlI CCTC 2 cut(s) 55, 90
MseI TTAA 1 cut(s) 246
MspA1I CMGCKG 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 258
MvaI CCWGG 1 cut(s) 258
MwoI GCNNNNNNNGC 1 cut(s) 100
NdeII GATC 3 cut(s) 136, 154, 226
NlaIV GGNNCC 1 cut(s) 66
PfeI GAWTC 1 cut(s) 266
Pfl23II CGTACG 1 cut(s) 108
PflMI CCANNNNNTGG 1 cut(s) 209
PkrI GCNGC 2 cut(s) 88, 105
PleI GAGTC 1 cut(s) 157
PpsI GAGTC 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 256
PspGI CCWGG 1 cut(s) 256
PspLI CGTACG 1 cut(s) 108
PspN4I GGNNCC 1 cut(s) 66
PspPI GGNCC 1 cut(s) 200
PstNI CAGNNNCTG 1 cut(s) 257
PvuII CAGCTG 1 cut(s) 86
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
SaqAI TTAA 1 cut(s) 246
SatI GCNGC 2 cut(s) 87, 104
Sau3AI GATC 3 cut(s) 136, 154, 226
Sau96I GGNCC 1 cut(s) 200
SchI GAGTC 1 cut(s) 157
ScrFI CCNGG 1 cut(s) 258
SetI ASST 6 cut(s) 13, 20, 82, 88, 134, 196
SfaNI GCATC 1 cut(s) 123
SgeI CNNG 8 cut(s) 95, 107, 157, 222, 269, 270, 287, 295
Sse9I AATT 1 cut(s) 205
SsiI CCGC 3 cut(s) 24, 104, 261
StyD4I CCNGG 1 cut(s) 256
TaqI TCGA 1 cut(s) 117
TasI AATT 1 cut(s) 205
TauI GCSGC 1 cut(s) 106
TfiI GAWTC 1 cut(s) 266
Tru1I TTAA 1 cut(s) 246
Tru9I TTAA 1 cut(s) 246
TseI GCWGC 1 cut(s) 86
TspDTI ATGAA 1 cut(s) 258
Van91I CCANNNNNTGG 1 cut(s) 209
XapI RAATTY 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.