MD06G1089300.v1.1

SPIRAL1-like 5

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Forward (+)
21759479 .. 21760358
880 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1089300.v1.1.491

Sequence Viewer

Length: 318 bp
ATGAGTAGAGGTGGGAGCTATGGTGGGGGGCAAAGCTCATTGGGGTACTTGTTTGGCTCAGATGATCAGAAGCAAAGTCCACCTTCAACAGCTAAGCCAGTAATACCCCCATATGGCATCGATAGATTTGATTCCAGCAGTGAATTTAAGCCTCCAAATACTCCTACTAACTCTTCAGAAAAACAAAAAAATTCCAACAACTATCACAGAGCTGAAGGCCAAAATTCTGGGAACTTCTTAACTGATCGTCCGACAACAAAAGTTAAATCAGCTCCTGGTGGAGATTCATCACTTGGGTACTTGTTTGGAGCTAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.14

Weight (kDa)

9.26

Isoelectric Point (pI)

53.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013065)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 143, 190, 223
AcuI CTGAAG 2 cut(s) 159, 234
AfaI GTAC 2 cut(s) 47, 299
AfiI CCNNNNNNNGG 1 cut(s) 113
AgsI TTSAA 1 cut(s) 87
AjnI CCWGG 1 cut(s) 274
AluBI AGCT 6 cut(s) 18, 36, 92, 212, 272, 311
AluI AGCT 6 cut(s) 18, 36, 92, 212, 272, 311
AlwNI CAGNNNCTG 1 cut(s) 275
AoxI GGCC 1 cut(s) 217
ApoI RAATTY 3 cut(s) 143, 190, 223
BciT130I CCWGG 1 cut(s) 276
BclI TGATCA 1 cut(s) 64
BlpI GCTNAGC 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 276
BmrFI CCNGG 1 cut(s) 276
BmsI GCATC 1 cut(s) 126
Bpu1102I GCTNAGC 1 cut(s) 93
Bsa29I ATCGAT 1 cut(s) 120
BsaXI ACNNNNNCTCC 2 cut(s) 7, 37
Bsc4I CCNNNNNNNGG 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 98
BseBI CCWGG 1 cut(s) 276
BseCI ATCGAT 1 cut(s) 120
BseLI CCNNNNNNNGG 1 cut(s) 113
BseMII CTCAG 1 cut(s) 72
BseNI ACTGG 1 cut(s) 98
BshFI GGCC 1 cut(s) 219
BshVI ATCGAT 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 113
BsnI GGCC 1 cut(s) 219
Bsp143I GATC 2 cut(s) 64, 244
Bsp1720I GCTNAGC 1 cut(s) 93
BspANI GGCC 1 cut(s) 219
BspCNI CTCAG 1 cut(s) 71
BspDI ATCGAT 1 cut(s) 120
BsrI ACTGG 1 cut(s) 98
BssMI GATC 2 cut(s) 64, 244
Bst2UI CCWGG 1 cut(s) 276
Bst6I CTCTTC 1 cut(s) 178
BstDEI CTNAG 3 cut(s) 58, 93, 312
BstKTI GATC 2 cut(s) 67, 247
BstMBI GATC 2 cut(s) 64, 244
BstNI CCWGG 1 cut(s) 276
BstSCI CCNGG 1 cut(s) 274
BstXI CCANNNNNNTGG 1 cut(s) 227
Bsu15I ATCGAT 1 cut(s) 120
BsuRI GGCC 1 cut(s) 219
BsuTUI ATCGAT 1 cut(s) 120
BtsI GCAGTG 1 cut(s) 145
BtsIMutI CAGTG 1 cut(s) 145
CaiI CAGNNNCTG 1 cut(s) 275
ClaI ATCGAT 1 cut(s) 120
Csp6I GTAC 2 cut(s) 46, 298
CviQI GTAC 2 cut(s) 46, 298
DdeI CTNAG 3 cut(s) 58, 93, 312
DpnI GATC 2 cut(s) 66, 246
DpnII GATC 2 cut(s) 64, 244
Eam1104I CTCTTC 1 cut(s) 178
EarI CTCTTC 1 cut(s) 178
Eco57I CTGAAG 2 cut(s) 159, 234
EcoRII CCWGG 1 cut(s) 274
FaiI YATR 3 cut(s) 21, 112, 114
FalI AAGNNNNNCTT 2 cut(s) 67, 99
FauNDI CATATG 1 cut(s) 112
FbaI TGATCA 1 cut(s) 64
HaeIII GGCC 1 cut(s) 219
HinfI GANTC 2 cut(s) 131, 284
Hpy166II GTNNAC 1 cut(s) 80
Hpy188I TCNGA 4 cut(s) 61, 69, 178, 252
Hpy8I GTNNAC 1 cut(s) 80
HpyAV CCTTC 2 cut(s) 93, 209
HpyF3I CTNAG 3 cut(s) 58, 93, 312
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 2 cut(s) 64, 244
LmnI GCTCC 3 cut(s) 15, 277, 308
LpnPI CCDG 5 cut(s) 111, 148, 213, 261, 288
LweI GCATC 1 cut(s) 126
MalI GATC 2 cut(s) 66, 246
MboI GATC 2 cut(s) 64, 244
MboII GAAGA 1 cut(s) 165
MluCI AATT 3 cut(s) 143, 190, 223
MmeI TCCRAC 2 cut(s) 219, 275
MnlI CCTC 1 cut(s) 162
MseI TTAA 3 cut(s) 147, 239, 264
MspR9I CCNGG 1 cut(s) 276
MvaI CCWGG 1 cut(s) 276
NdeI CATATG 1 cut(s) 112
NdeII GATC 2 cut(s) 64, 244
PfeI GAWTC 2 cut(s) 131, 284
Psp6I CCWGG 1 cut(s) 274
PspGI CCWGG 1 cut(s) 274
PstNI CAGNNNCTG 1 cut(s) 275
RsaI GTAC 2 cut(s) 47, 299
RsaNI GTAC 2 cut(s) 46, 298
SaqAI TTAA 3 cut(s) 147, 239, 264
Sau3AI GATC 2 cut(s) 64, 244
ScrFI CCNGG 1 cut(s) 276
SetI ASST 8 cut(s) 13, 20, 38, 85, 94, 214, 274, 313
SfaNI GCATC 1 cut(s) 126
SgeI CNNG 8 cut(s) 61, 110, 147, 240, 287, 288, 305, 313
Sse9I AATT 3 cut(s) 143, 190, 223
StyD4I CCNGG 1 cut(s) 274
TaqI TCGA 1 cut(s) 120
TasI AATT 3 cut(s) 143, 190, 223
TfiI GAWTC 2 cut(s) 131, 284
Tru1I TTAA 3 cut(s) 147, 239, 264
Tru9I TTAA 3 cut(s) 147, 239, 264
TscAI CASTG 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 276
TspRI CASTG 1 cut(s) 145
XapI RAATTY 3 cut(s) 143, 190, 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.