pycom14g10480

SPIRAL1-like 5

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
OG0013065
Physical Location & Seq
Forward (+)
13164412 .. 13164837
426 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g10480.2

Sequence Viewer

Length: 318 bp
ATGAGTAGAGGTGGGAGCTATGGTGGGGGACAAAGCTCATTGGGATATTTGTTCGGCTCAGATGATCAGCAACAAAGTCCACCTCCAACCGCTAAGCCGGTAATACCACCATATGGCATCGATAGATTCGATTCTAGCACTGAATTTAAGCCTCCAGATACGCCTGCTAACTCTTCAGAAAAACATAAAATTTCCAACAACTATCACAGAGCTGATGGCCAAAATTCTGGGAACTTCTTAACTGATCGTCCGACAACAAAAGTTAAATCAGCTCCTGGTGGAGATTCATCACTTGGGTACTTGTTTGGAGATAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.17

Weight (kDa)

6.71

Isoelectric Point (pI)

53.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013065)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G23496
fragaria_vesca FvH4_5g03030
malus_domestica MD06G1089300.v1.1 MD06G1158500.v1.1 MD14G1110000.v1.1
prunus_persica Prupe.5G105200_v2.0.a1 Prupe.5G105300_v2.0.a1
pyrus_communis pycom06g08520 pycom14g10480
rosa_chinensis RchiOBHm_Chr7g0196801
rosa_multiflora Rmu_sc0001083.1_g000028
rosa_roxburghii Rroxscaffold_3G00258940
rosa_rugosa Rorug07G0036200
rosa_samantha Rh7AG160400 Rh7BG162500 Rh7CG168800 Rh7DG161700
rosa_wichuraiana Rw7G014020

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 113
AciI CCGC 1 cut(s) 90
AcoI YGGCCR 1 cut(s) 217
AcsI RAATTY 3 cut(s) 143, 189, 223
AcuI CTGAAG 1 cut(s) 159
AfaI GTAC 1 cut(s) 299
AfiI CCNNNNNNNGG 1 cut(s) 113
AjnI CCWGG 1 cut(s) 274
AluBI AGCT 4 cut(s) 18, 36, 212, 272
AluI AGCT 4 cut(s) 18, 36, 212, 272
AlwNI CAGNNNCTG 1 cut(s) 275
AoxI GGCC 1 cut(s) 217
ApoI RAATTY 3 cut(s) 143, 189, 223
BalI TGGCCA 1 cut(s) 219
BccI CCATC 1 cut(s) 209
BciT130I CCWGG 1 cut(s) 276
BclI TGATCA 1 cut(s) 64
BfaI CTAG 1 cut(s) 135
BlpI GCTNAGC 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 276
BmrFI CCNGG 1 cut(s) 276
BmsI GCATC 1 cut(s) 126
BpmI CTGGAG 1 cut(s) 138
Bpu1102I GCTNAGC 1 cut(s) 93
Bsa29I ATCGAT 1 cut(s) 120
BsaXI ACNNNNNCTCC 2 cut(s) 7, 37
Bsc4I CCNNNNNNNGG 1 cut(s) 113
Bse118I RCCGGY 1 cut(s) 97
BseBI CCWGG 1 cut(s) 276
BseCI ATCGAT 1 cut(s) 120
BseLI CCNNNNNNNGG 1 cut(s) 113
BseMII CTCAG 1 cut(s) 72
BshFI GGCC 1 cut(s) 219
BshVI ATCGAT 1 cut(s) 120
BsiSI CCGG 1 cut(s) 98
BslFI GGGAC 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 113
BsmFI GGGAC 1 cut(s) 42
BsnI GGCC 1 cut(s) 219
Bsp143I GATC 2 cut(s) 64, 244
Bsp1720I GCTNAGC 1 cut(s) 93
BspACI CCGC 1 cut(s) 90
BspANI GGCC 1 cut(s) 219
BspCNI CTCAG 1 cut(s) 71
BspDI ATCGAT 1 cut(s) 120
BsrFI RCCGGY 1 cut(s) 97
BssAI RCCGGY 1 cut(s) 97
BssMI GATC 2 cut(s) 64, 244
Bst2UI CCWGG 1 cut(s) 276
Bst6I CTCTTC 1 cut(s) 178
BstC8I GCNNGC 1 cut(s) 165
BstDEI CTNAG 2 cut(s) 58, 93
BstKTI GATC 2 cut(s) 67, 247
BstMBI GATC 2 cut(s) 64, 244
BstNI CCWGG 1 cut(s) 276
BstSCI CCNGG 1 cut(s) 274
BstXI CCANNNNNNTGG 1 cut(s) 227
Bsu15I ATCGAT 1 cut(s) 120
BsuRI GGCC 1 cut(s) 219
BsuTUI ATCGAT 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 165
CaiI CAGNNNCTG 1 cut(s) 275
Cfr10I RCCGGY 1 cut(s) 97
ClaI ATCGAT 1 cut(s) 120
Csp6I GTAC 1 cut(s) 298
CviJI RGCY 8 cut(s) 18, 36, 57, 97, 151, 212, 219, 272
CviKI_1 RGCY 8 cut(s) 18, 36, 57, 97, 151, 212, 219, 272
CviQI GTAC 1 cut(s) 298
DdeI CTNAG 2 cut(s) 58, 93
DpnI GATC 2 cut(s) 66, 246
DpnII GATC 2 cut(s) 64, 244
EaeI YGGCCR 1 cut(s) 217
Eam1104I CTCTTC 1 cut(s) 178
EarI CTCTTC 1 cut(s) 178
Eco57I CTGAAG 1 cut(s) 159
EcoRII CCWGG 1 cut(s) 274
FaiI YATR 4 cut(s) 21, 112, 114, 186
FaqI GGGAC 1 cut(s) 42
FauNDI CATATG 1 cut(s) 112
FbaI TGATCA 1 cut(s) 64
FspBI CTAG 1 cut(s) 135
GsuI CTGGAG 1 cut(s) 138
HaeIII GGCC 1 cut(s) 219
HapII CCGG 1 cut(s) 98
HinfI GANTC 3 cut(s) 126, 131, 284
HpaII CCGG 1 cut(s) 98
Hpy166II GTNNAC 1 cut(s) 80
Hpy188I TCNGA 3 cut(s) 61, 178, 252
Hpy188III TCNNGA 1 cut(s) 155
Hpy8I GTNNAC 1 cut(s) 80
HpyF3I CTNAG 2 cut(s) 58, 93
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 2 cut(s) 64, 244
LmnI GCTCC 2 cut(s) 15, 277
LpnPI CCDG 6 cut(s) 111, 168, 177, 213, 261, 288
LweI GCATC 1 cut(s) 126
MaeI CTAG 1 cut(s) 135
MalI GATC 2 cut(s) 66, 246
MboI GATC 2 cut(s) 64, 244
MboII GAAGA 1 cut(s) 165
MlsI TGGCCA 1 cut(s) 219
MluCI AATT 3 cut(s) 143, 189, 223
MluNI TGGCCA 1 cut(s) 219
MmeI TCCRAC 3 cut(s) 110, 219, 275
MnlI CCTC 2 cut(s) 93, 162
Mox20I TGGCCA 1 cut(s) 219
MscI TGGCCA 1 cut(s) 219
MseI TTAA 3 cut(s) 147, 239, 264
Msp20I TGGCCA 1 cut(s) 219
MspI CCGG 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 276
MvaI CCWGG 1 cut(s) 276
NdeI CATATG 1 cut(s) 112
NdeII GATC 2 cut(s) 64, 244
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PfeI GAWTC 3 cut(s) 126, 131, 284
PflMI CCANNNNNTGG 1 cut(s) 113
Psp6I CCWGG 1 cut(s) 274
PspGI CCWGG 1 cut(s) 274
PstNI CAGNNNCTG 1 cut(s) 275
RsaI GTAC 1 cut(s) 299
RsaNI GTAC 1 cut(s) 298
SaqAI TTAA 3 cut(s) 147, 239, 264
Sau3AI GATC 2 cut(s) 64, 244
ScrFI CCNGG 1 cut(s) 276
SetI ASST 6 cut(s) 13, 20, 38, 85, 214, 274
SfaNI GCATC 1 cut(s) 126
SgeI CNNG 9 cut(s) 110, 147, 167, 176, 240, 287, 288, 305, 313
Sse9I AATT 3 cut(s) 143, 189, 223
SsiI CCGC 1 cut(s) 90
SspMI CTAG 1 cut(s) 135
StyD4I CCNGG 1 cut(s) 274
TaqI TCGA 2 cut(s) 120, 129
TasI AATT 3 cut(s) 143, 189, 223
TfiI GAWTC 3 cut(s) 126, 131, 284
Tru1I TTAA 3 cut(s) 147, 239, 264
Tru9I TTAA 3 cut(s) 147, 239, 264
TscAI CASTG 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 276
TspRI CASTG 1 cut(s) 145
Van91I CCANNNNNTGG 1 cut(s) 113
XapI RAATTY 3 cut(s) 143, 189, 223
XspI CTAG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.