FvH4_5g22590

Signal recognition particle 14 kDa

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
13922658 .. 13924999
2342 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g22590.t1

Sequence Viewer

Length: 372 bp
ATGGTTCTTCTACAGCCAGATCCCTTCCTTAATGAGCTTACCAGCATGTTTGAGAAAAGCACAGAGAAGGGGTCCGTTTGGGTTACCTTCAAAAGATCATCCTTGAAGTCAAAGGTGCAGAGGAATAAAATGAAAACTGCTGGTCAAGCAATTGACTACAGATGCCTAATCCGTGCAACATATGGGAACAAGACAATATCTACTTCGGTTGGGGCAAAGGAACATCAGCGATTTCAAGCTTCTTACGCAACTGTCCTAAAGGCTCACATGACTGCTTTAAAGAAGCGGGAGAGGAAGGATAAGAAAAAGGCTGCGGAGAAGAAAAAAGGGGGTGCAAAGAAGGCCAAGGTGGATCCCATGGTCGTAGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

13.84

Weight (kDa)

10.32

Isoelectric Point (pI)

23.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRP14 PF02290 4 - 93 6.9e-26 Signal recognition particle 14kD protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012105)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 286, 314
AclWI GGATC 3 cut(s) 14, 347, 360
AgsI TTSAA 3 cut(s) 91, 106, 236
AluBI AGCT 2 cut(s) 37, 239
AluI AGCT 2 cut(s) 37, 239
AlwI GGATC 3 cut(s) 14, 347, 360
AoxI GGCC 1 cut(s) 342
ApeKI GCWGC 1 cut(s) 311
AspS9I GGNCC 1 cut(s) 72
AvaII GGWCC 1 cut(s) 72
BamHI GGATCC 1 cut(s) 352
BbvI GCAGC 1 cut(s) 298
BfmI CTRYAG 2 cut(s) 11, 157
BisI GCNGC 1 cut(s) 312
BlsI GCNGC 1 cut(s) 313
Bme18I GGWCC 1 cut(s) 72
BmgT120I GGNCC 1 cut(s) 72
BmiI GGNNCC 2 cut(s) 73, 354
BmsI GCATC 1 cut(s) 152
BsaJI CCNNGG 2 cut(s) 345, 357
BseDI CCNNGG 2 cut(s) 345, 357
BseGI GGATG 1 cut(s) 98
BseXI GCAGC 1 cut(s) 298
BsgI GTGCAG 1 cut(s) 137
BshFI GGCC 1 cut(s) 344
BsnI GGCC 1 cut(s) 344
Bsp143I GATC 3 cut(s) 19, 95, 352
Bsp19I CCATGG 1 cut(s) 357
BspACI CCGC 2 cut(s) 286, 314
BspANI GGCC 1 cut(s) 344
BspLI GGNNCC 2 cut(s) 73, 354
BspPI GGATC 3 cut(s) 14, 347, 360
BssECI CCNNGG 2 cut(s) 345, 357
BssMI GATC 3 cut(s) 19, 95, 352
BssT1I CCWWGG 2 cut(s) 345, 357
Bst4CI ACNGT 1 cut(s) 253
BstDSI CCRYGG 1 cut(s) 357
BstEII GGTNACC 1 cut(s) 82
BstF5I GGATG 1 cut(s) 98
BstKTI GATC 3 cut(s) 22, 98, 355
BstMBI GATC 3 cut(s) 19, 95, 352
BstMWI GCNNNNNNNGC 3 cut(s) 146, 245, 341
BstNSI RCATGY 1 cut(s) 49
BstPI GGTNACC 1 cut(s) 82
BstSFI CTRYAG 2 cut(s) 11, 157
BstV1I GCAGC 1 cut(s) 298
BstX2I RGATCY 2 cut(s) 19, 352
BstYI RGATCY 2 cut(s) 19, 352
BsuRI GGCC 1 cut(s) 344
BtgI CCRYGG 1 cut(s) 357
BtsCI GGATG 1 cut(s) 98
Cfr13I GGNCC 1 cut(s) 72
CviAII CATG 3 cut(s) 46, 268, 358
CviJI RGCY 7 cut(s) 16, 37, 239, 263, 311, 344, 368
CviKI_1 RGCY 7 cut(s) 16, 37, 239, 263, 311, 344, 368
DpnI GATC 3 cut(s) 21, 97, 354
DpnII GATC 3 cut(s) 19, 95, 352
DraI TTTAAA 1 cut(s) 279
Eco130I CCWWGG 2 cut(s) 345, 357
Eco47I GGWCC 1 cut(s) 72
Eco91I GGTNACC 1 cut(s) 82
EcoO65I GGTNACC 1 cut(s) 82
EcoT14I CCWWGG 2 cut(s) 345, 357
ErhI CCWWGG 2 cut(s) 345, 357
FaeI CATG 3 cut(s) 49, 271, 361
FaiI YATR 5 cut(s) 47, 181, 183, 269, 359
FatI CATG 3 cut(s) 45, 267, 357
FauI CCCGC 1 cut(s) 279
FauNDI CATATG 1 cut(s) 181
Fnu4HI GCNGC 1 cut(s) 312
FokI GGATG 1 cut(s) 85
Fsp4HI GCNGC 1 cut(s) 312
GluI GCNGC 1 cut(s) 312
HaeIII GGCC 1 cut(s) 344
Hin1II CATG 3 cut(s) 49, 271, 361
HindIII AAGCTT 1 cut(s) 237
HpyAV CCTTC 5 cut(s) 34, 61, 97, 289, 334
HpyCH4III ACNGT 1 cut(s) 253
HpyCH4V TGCA 3 cut(s) 118, 176, 335
HpyF10VI GCNNNNNNNGC 3 cut(s) 146, 245, 341
Hsp92II CATG 3 cut(s) 49, 271, 361
Kzo9I GATC 3 cut(s) 19, 95, 352
LpnPI CCDG 3 cut(s) 30, 55, 126
Lsp1109I GCAGC 1 cut(s) 298
LweI GCATC 1 cut(s) 152
MaeIII GTNAC 1 cut(s) 82
MalI GATC 3 cut(s) 21, 97, 354
MboI GATC 3 cut(s) 19, 95, 352
MboII GAAGA 1 cut(s) 331
MfeI CAATTG 1 cut(s) 150
MflI RGATCY 2 cut(s) 19, 352
MluCI AATT 1 cut(s) 150
MnlI CCTC 2 cut(s) 114, 285
MseI TTAA 2 cut(s) 30, 278
MunI CAATTG 1 cut(s) 150
MwoI GCNNNNNNNGC 3 cut(s) 146, 245, 341
NcoI CCATGG 1 cut(s) 357
NdeI CATATG 1 cut(s) 181
NdeII GATC 3 cut(s) 19, 95, 352
NlaIII CATG 3 cut(s) 49, 271, 361
NlaIV GGNNCC 2 cut(s) 73, 354
NspI RCATGY 1 cut(s) 49
PkrI GCNGC 1 cut(s) 313
PspEI GGTNACC 1 cut(s) 82
PspN4I GGNNCC 2 cut(s) 73, 354
PspPI GGNCC 1 cut(s) 72
PsuI RGATCY 2 cut(s) 19, 352
SaqAI TTAA 2 cut(s) 30, 278
SatI GCNGC 1 cut(s) 312
Sau3AI GATC 3 cut(s) 19, 95, 352
Sau96I GGNCC 1 cut(s) 72
SetI ASST 5 cut(s) 39, 89, 117, 241, 351
SfaNI GCATC 1 cut(s) 152
SfcI CTRYAG 2 cut(s) 11, 157
SinI GGWCC 1 cut(s) 72
Sse9I AATT 1 cut(s) 150
SsiI CCGC 2 cut(s) 286, 314
StyI CCWWGG 2 cut(s) 345, 357
TaaI ACNGT 1 cut(s) 253
TasI AATT 1 cut(s) 150
Tru1I TTAA 2 cut(s) 30, 278
Tru9I TTAA 2 cut(s) 30, 278
TseI GCWGC 1 cut(s) 311
TspDTI ATGAA 1 cut(s) 146
TspGWI ACGGA 2 cut(s) 64, 161
VpaK11BI GGWCC 1 cut(s) 72
XceI RCATGY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.