FvH4_6g03000

Cytoskeletal-regulatory complex EF hand

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0013796
Physical Location & Seq
Forward (+)
1672916 .. 1674319
1404 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g03000.t1

Sequence Viewer

Length: 453 bp
ATGGGAGAGGTTCTAAGTGAAGAACAGATTGCTGAGTTTCAGGAAGCCTTCTGTCTTTTTGACAAGGATGGAGATGGATGCATTACAATCGAAGAACTCGCCACCGCGATCAAATCGGTGGATCAAAATCCGACGGCAGAAGAACTGCAGAGCATGATAAACGAAGTTGATATTGACGGCAACGGAACCATAGAATTTGGGGAGTTTCTCAATGTCATGGTGAGGAAAATGAAGGAAAATGACGCGGACGAGGAATTGAAAGAAGCTTTTAAAGTGTTCGATAAGGATCAAGATGGCTACATTTCACCTAATGAGTTGAGGAATGTGATGATTAACCTGGGGGAGAGATTGACGGATGAAGAGGCAGAGCAAATGATCAGAGAAGCTGATTTGGATGGTGATGGCTTAGTCAATTATGAAGAATTTGTGACAATGATGTTATTAGCTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1

Protein Analysis

151

Amino Acids

16.99

Weight (kDa)

4.05

Isoelectric Point (pI)

37.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_1 PF00036 12 - 39 1.7e-08 EF hand domain
EF-hand_7 PF13499 12 - 73 7.3e-16 EF-hand domain pair
EF-hand_6 PF13405 12 - 39 1.5e-07 EF-hand domain
EF-hand_9 PF14658 16 - 75 2.6e-08 EF-hand domain
EF-hand_8 PF13833 25 - 75 3e-10 EF-hand domain pair
EF-hand_1 PF00036 48 - 74 8.4e-07 EF hand domain
EF-hand_7 PF13499 84 - 146 8.1e-20 EF-hand domain pair
EF-hand_1 PF00036 85 - 112 1.6e-09 EF hand domain
EF-hand_6 PF13405 85 - 114 1.8e-09 EF-hand domain
EF-hand_5 PF13202 86 - 110 1.2e-07 EF hand
EF-hand_8 PF13833 107 - 146 3.9e-07 EF-hand domain pair
EF-hand_1 PF00036 121 - 146 7.4e-08 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013796)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g03000
malus_domestica MD04G1223900.v1.1
prunus_persica Prupe.6G342600_v2.0.a1 Prupe.6G342600_v2.0.a1
pyrus_communis pycom04g19730
rosa_chinensis RchiOBHm_Chr3g0451781
rosa_laevigata RLG00000025650
rosa_multiflora Rmu_sc0006510.1_g000021
rosa_roxburghii Rroxscaffold_164G00436320 Rroxscaffold_6G00428970
rosa_rugosa Rorug02G0636000 Rorug02G0636100 Rorug02G0636200.1
rosa_samantha Rh3AG037700 Rh3CG037300 Rh3DG038100
rosa_wichuraiana Rw3G002810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 107, 245
AciI CCGC 2 cut(s) 105, 245
AclWI GGATC 2 cut(s) 129, 294
AcsI RAATTY 2 cut(s) 194, 422
AgsI TTSAA 1 cut(s) 259
AjnI CCWGG 1 cut(s) 336
AluBI AGCT 3 cut(s) 266, 386, 446
AluI AGCT 3 cut(s) 266, 386, 446
AlwI GGATC 2 cut(s) 129, 294
ApoI RAATTY 2 cut(s) 194, 422
AsuHPI GGTGA 3 cut(s) 232, 297, 410
BccI CCATC 5 cut(s) 62, 68, 287, 389, 395
BceAI ACGGC 2 cut(s) 150, 193
BcgI CGANNNNNNTGC 2 cut(s) 70, 104
BciT130I CCWGG 1 cut(s) 338
BclI TGATCA 1 cut(s) 375
BfmI CTRYAG 1 cut(s) 146
Bme1390I CCNGG 1 cut(s) 338
BmiI GGNNCC 1 cut(s) 187
BmrFI CCNGG 1 cut(s) 338
BmsI GCATC 1 cut(s) 68
BsaBI GATNNNNATC 2 cut(s) 126, 285
BsaJI CCNNGG 1 cut(s) 337
Bse8I GATNNNNATC 2 cut(s) 126, 285
BseBI CCWGG 1 cut(s) 338
BseDI CCNNGG 1 cut(s) 337
BseGI GGATG 4 cut(s) 73, 83, 361, 400
BseJI GATNNNNATC 2 cut(s) 126, 285
BseMII CTCAG 1 cut(s) 24
Bsh1236I CGCG 2 cut(s) 107, 245
Bsp143I GATC 4 cut(s) 108, 121, 286, 375
BspACI CCGC 2 cut(s) 105, 245
BspCNI CTCAG 1 cut(s) 25
BspFNI CGCG 2 cut(s) 107, 245
BspLI GGNNCC 1 cut(s) 187
BspMAI CTGCAG 1 cut(s) 150
BspPI GGATC 2 cut(s) 129, 294
BssECI CCNNGG 1 cut(s) 337
BssMI GATC 4 cut(s) 108, 121, 286, 375
Bst2UI CCWGG 1 cut(s) 338
Bst6I CTCTTC 1 cut(s) 354
BstDEI CTNAG 3 cut(s) 14, 33, 406
BstF5I GGATG 4 cut(s) 73, 83, 361, 400
BstFNI CGCG 2 cut(s) 107, 245
BstKTI GATC 4 cut(s) 111, 124, 289, 378
BstMBI GATC 4 cut(s) 108, 121, 286, 375
BstNI CCWGG 1 cut(s) 338
BstSCI CCNGG 1 cut(s) 336
BstSFI CTRYAG 1 cut(s) 146
BstUI CGCG 2 cut(s) 107, 245
BtsCI GGATG 4 cut(s) 73, 83, 361, 400
CseI GACGC 1 cut(s) 251
CviAII CATG 2 cut(s) 154, 217
CviJI RGCY 6 cut(s) 47, 266, 297, 386, 405, 446
CviKI_1 RGCY 6 cut(s) 47, 266, 297, 386, 405, 446
DdeI CTNAG 3 cut(s) 14, 33, 406
DpnI GATC 4 cut(s) 110, 123, 288, 377
DpnII GATC 4 cut(s) 108, 121, 286, 375
DraI TTTAAA 1 cut(s) 271
Eam1104I CTCTTC 1 cut(s) 354
EarI CTCTTC 1 cut(s) 354
EcoRII CCWGG 1 cut(s) 336
EcoT22I ATGCAT 1 cut(s) 83
FaeI CATG 2 cut(s) 157, 220
FaiI YATR 4 cut(s) 155, 191, 218, 417
FatI CATG 2 cut(s) 153, 216
FbaI TGATCA 1 cut(s) 375
FokI GGATG 4 cut(s) 80, 90, 368, 407
HgaI GACGC 1 cut(s) 251
Hin1II CATG 2 cut(s) 157, 220
HindIII AAGCTT 1 cut(s) 264
HphI GGTGA 3 cut(s) 232, 297, 410
Hpy188I TCNGA 3 cut(s) 132, 380, 452
Hpy188III TCNNGA 2 cut(s) 41, 290
Hpy99I CGWCG 1 cut(s) 136
HpyAV CCTTC 2 cut(s) 58, 226
HpyCH4V TGCA 2 cut(s) 81, 148
HpyF3I CTNAG 3 cut(s) 14, 33, 406
Hsp92II CATG 2 cut(s) 157, 220
Ksp22I TGATCA 1 cut(s) 375
Kzo9I GATC 4 cut(s) 108, 121, 286, 375
LpnPI CCDG 3 cut(s) 26, 323, 350
LweI GCATC 1 cut(s) 68
MaeIII GTNAC 1 cut(s) 427
MalI GATC 4 cut(s) 110, 123, 288, 377
MboI GATC 4 cut(s) 108, 121, 286, 375
MboII GAAGA 5 cut(s) 32, 104, 152, 371, 431
MluCI AATT 4 cut(s) 194, 254, 412, 422
MmeI TCCRAC 1 cut(s) 155
MnlI CCTC 4 cut(s) 216, 244, 312, 355
Mph1103I ATGCAT 1 cut(s) 83
MseI TTAA 2 cut(s) 270, 333
MspR9I CCNGG 1 cut(s) 338
MvaI CCWGG 1 cut(s) 338
MvnI CGCG 2 cut(s) 107, 245
NdeII GATC 4 cut(s) 108, 121, 286, 375
NlaIII CATG 2 cut(s) 157, 220
NlaIV GGNNCC 1 cut(s) 187
NmuCI GTSAC 1 cut(s) 427
NsiI ATGCAT 1 cut(s) 83
Psp6I CCWGG 1 cut(s) 336
PspGI CCWGG 1 cut(s) 336
PspN4I GGNNCC 1 cut(s) 187
PstI CTGCAG 1 cut(s) 150
SaqAI TTAA 2 cut(s) 270, 333
Sau3AI GATC 4 cut(s) 108, 121, 286, 375
ScrFI CCNGG 1 cut(s) 338
SetI ASST 6 cut(s) 12, 268, 310, 339, 388, 448
SfaNI GCATC 1 cut(s) 68
SfcI CTRYAG 1 cut(s) 146
Sse9I AATT 4 cut(s) 194, 254, 412, 422
SsiI CCGC 2 cut(s) 105, 245
StyD4I CCNGG 1 cut(s) 336
TaqI TCGA 2 cut(s) 90, 279
TasI AATT 4 cut(s) 194, 254, 412, 422
Tru1I TTAA 2 cut(s) 270, 333
Tru9I TTAA 2 cut(s) 270, 333
TseFI GTSAC 1 cut(s) 427
Tsp45I GTSAC 1 cut(s) 427
TspDTI ATGAA 3 cut(s) 245, 372, 432
TspGWI ACGGA 2 cut(s) 198, 368
XapI RAATTY 2 cut(s) 194, 422
Zsp2I ATGCAT 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.