RLG00000025650

EF-hand domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
OG0013796
Physical Location & Seq
Forward (+)
47360633 .. 47362105
1473 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000025650

Sequence Viewer

Length: 405 bp
ATGTTTGGTTTGTTTAAATATTCATTAGGCTGCATTACAATCGAAGAACTTGCCACCGCAATTAAATCAGTGGATCAAAATCCGACCGCAGAAGAACTGCAGAACATGATAAGCGAAGTTGATATTGACGGGAACGGAACCATAGAATTTGGGGAGTTCCTCAATGTCATGGTGACGAAAATGAAGGAAAATGACGCGGACGAGGAATTGAAAGAAGCTTTCAAAGTGTTCGATAAGGATCAAGATGGCTACATTTCACCTAAAGAGTTGAGGAATGTGATGATTAATCTGGGAGAAAGATTGACAGATGAAGAGGTAGAGCAGATGATCAGAGAAGCTGATTTGGATGGTGATGGCCTAGTCAATTATGAAGAATTTGTGAGAATGATGTTAGCTGCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1

Protein Analysis

135

Amino Acids

15.25

Weight (kDa)

4.1

Isoelectric Point (pI)

30.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 10 - 57 1.7e-07 EF-hand domain pair
EF-hand_8 PF13833 10 - 58 3e-09 EF-hand domain pair
EF-hand_1 PF00036 32 - 58 5.3e-07 EF hand domain
EF-hand_7 PF13499 68 - 130 1.8e-20 EF-hand domain pair
AIF-1 PF21008 68 - 132 2.6e-06 Allograft inflammatory factor 1
EF-hand_1 PF00036 69 - 96 1.4e-09 EF hand domain
EF-hand_6 PF13405 69 - 98 1.6e-09 EF-hand domain
EF-hand_5 PF13202 70 - 94 6.4e-08 EF hand
EF-hand_8 PF13833 91 - 130 5.5e-08 EF-hand domain pair
EF-hand_1 PF00036 105 - 130 1.8e-08 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013796)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g03000
malus_domestica MD04G1223900.v1.1
prunus_persica Prupe.6G342600_v2.0.a1 Prupe.6G342600_v2.0.a1
pyrus_communis pycom04g19730
rosa_chinensis RchiOBHm_Chr3g0451781
rosa_laevigata RLG00000025650
rosa_multiflora Rmu_sc0006510.1_g000021
rosa_roxburghii Rroxscaffold_164G00436320 Rroxscaffold_6G00428970
rosa_rugosa Rorug02G0636000 Rorug02G0636100 Rorug02G0636200.1
rosa_samantha Rh3AG037700 Rh3CG037300 Rh3DG038100
rosa_wichuraiana Rw3G002810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 197
AciI CCGC 3 cut(s) 57, 87, 197
AclWI GGATC 2 cut(s) 81, 246
AcsI RAATTY 2 cut(s) 146, 374
AgsI TTSAA 2 cut(s) 211, 223
AluBI AGCT 3 cut(s) 218, 338, 395
AluI AGCT 3 cut(s) 218, 338, 395
AlwI GGATC 2 cut(s) 81, 246
AoxI GGCC 1 cut(s) 355
ApeKI GCWGC 2 cut(s) 30, 395
ApoI RAATTY 2 cut(s) 146, 374
AseI ATTAAT 1 cut(s) 285
AsuHPI GGTGA 3 cut(s) 184, 249, 362
BbvI GCAGC 2 cut(s) 17, 382
BccI CCATC 3 cut(s) 239, 341, 347
BcgI CGANNNNNNTGC 4 cut(s) 22, 32, 56, 66
BclI TGATCA 1 cut(s) 327
BfaI CTAG 1 cut(s) 359
BfmI CTRYAG 1 cut(s) 98
BisI GCNGC 2 cut(s) 31, 396
BlsI GCNGC 2 cut(s) 32, 397
BmiI GGNNCC 1 cut(s) 139
BsaBI GATNNNNATC 2 cut(s) 78, 237
Bse8I GATNNNNATC 2 cut(s) 78, 237
BseGI GGATG 1 cut(s) 352
BseJI GATNNNNATC 2 cut(s) 78, 237
BseXI GCAGC 2 cut(s) 17, 382
Bsh1236I CGCG 1 cut(s) 197
Bsh1285I CGRYCG 1 cut(s) 87
BshFI GGCC 1 cut(s) 357
BsiEI CGRYCG 1 cut(s) 87
BsnI GGCC 1 cut(s) 357
Bsp143I GATC 3 cut(s) 73, 238, 327
BspACI CCGC 3 cut(s) 57, 87, 197
BspANI GGCC 1 cut(s) 357
BspFNI CGCG 1 cut(s) 197
BspLI GGNNCC 1 cut(s) 139
BspMAI CTGCAG 1 cut(s) 102
BspPI GGATC 2 cut(s) 81, 246
BssMI GATC 3 cut(s) 73, 238, 327
Bst6I CTCTTC 1 cut(s) 306
BstF5I GGATG 1 cut(s) 352
BstFNI CGCG 1 cut(s) 197
BstKTI GATC 3 cut(s) 76, 241, 330
BstMBI GATC 3 cut(s) 73, 238, 327
BstMCI CGRYCG 1 cut(s) 87
BstSFI CTRYAG 1 cut(s) 98
BstUI CGCG 1 cut(s) 197
BstV1I GCAGC 2 cut(s) 17, 382
BsuRI GGCC 1 cut(s) 357
BtsCI GGATG 1 cut(s) 352
BtsIMutI CAGTG 1 cut(s) 75
CseI GACGC 1 cut(s) 203
CviAII CATG 2 cut(s) 106, 169
CviJI RGCY 6 cut(s) 30, 218, 249, 338, 357, 395
CviKI_1 RGCY 6 cut(s) 30, 218, 249, 338, 357, 395
DpnI GATC 3 cut(s) 75, 240, 329
DpnII GATC 3 cut(s) 73, 238, 327
DraI TTTAAA 1 cut(s) 16
Eam1104I CTCTTC 1 cut(s) 306
EarI CTCTTC 1 cut(s) 306
FaeI CATG 2 cut(s) 109, 172
FaiI YATR 4 cut(s) 107, 143, 170, 369
FatI CATG 2 cut(s) 105, 168
FbaI TGATCA 1 cut(s) 327
Fnu4HI GCNGC 2 cut(s) 31, 396
FokI GGATG 1 cut(s) 359
Fsp4HI GCNGC 2 cut(s) 31, 396
FspBI CTAG 1 cut(s) 359
GluI GCNGC 2 cut(s) 31, 396
HaeIII GGCC 1 cut(s) 357
HgaI GACGC 1 cut(s) 203
Hin1II CATG 2 cut(s) 109, 172
HindIII AAGCTT 1 cut(s) 216
HphI GGTGA 3 cut(s) 184, 249, 362
Hpy188I TCNGA 2 cut(s) 84, 332
Hpy188III TCNNGA 1 cut(s) 242
HpyAV CCTTC 1 cut(s) 178
HpyCH4V TGCA 2 cut(s) 33, 100
Hsp92II CATG 2 cut(s) 109, 172
Ksp22I TGATCA 1 cut(s) 327
Kzo9I GATC 3 cut(s) 73, 238, 327
LpnPI CCDG 1 cut(s) 275
Lsp1109I GCAGC 2 cut(s) 17, 382
MaeI CTAG 1 cut(s) 359
MaeIII GTNAC 1 cut(s) 172
MalI GATC 3 cut(s) 75, 240, 329
MboI GATC 3 cut(s) 73, 238, 327
MboII GAAGA 4 cut(s) 56, 104, 323, 383
MluCI AATT 5 cut(s) 60, 146, 206, 364, 374
MmeI TCCRAC 1 cut(s) 107
MnlI CCTC 4 cut(s) 170, 196, 264, 307
MseI TTAA 3 cut(s) 15, 63, 285
MvnI CGCG 1 cut(s) 197
NdeII GATC 3 cut(s) 73, 238, 327
NlaIII CATG 2 cut(s) 109, 172
NlaIV GGNNCC 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 172
PkrI GCNGC 2 cut(s) 32, 397
PshBI ATTAAT 1 cut(s) 285
PspN4I GGNNCC 1 cut(s) 139
PstI CTGCAG 1 cut(s) 102
SaqAI TTAA 3 cut(s) 15, 63, 285
SatI GCNGC 2 cut(s) 31, 396
Sau3AI GATC 3 cut(s) 73, 238, 327
SetI ASST 5 cut(s) 220, 262, 318, 340, 397
SfcI CTRYAG 1 cut(s) 98
SgeI CNNG 9 cut(s) 62, 118, 142, 181, 208, 214, 254, 302, 371
Sse9I AATT 5 cut(s) 60, 146, 206, 364, 374
SsiI CCGC 3 cut(s) 57, 87, 197
SspI AATATT 1 cut(s) 20
SspMI CTAG 1 cut(s) 359
TaqI TCGA 2 cut(s) 42, 231
TasI AATT 5 cut(s) 60, 146, 206, 364, 374
Tru1I TTAA 3 cut(s) 15, 63, 285
Tru9I TTAA 3 cut(s) 15, 63, 285
TscAI CASTG 1 cut(s) 75
TseFI GTSAC 1 cut(s) 172
TseI GCWGC 2 cut(s) 30, 395
Tsp45I GTSAC 1 cut(s) 172
TspDTI ATGAA 4 cut(s) 12, 197, 324, 384
TspGWI ACGGA 1 cut(s) 150
TspRI CASTG 1 cut(s) 75
VspI ATTAAT 1 cut(s) 285
XapI RAATTY 2 cut(s) 146, 374
XspI CTAG 1 cut(s) 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.