FvH4_6g09870

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0015649
Physical Location & Seq
Forward (+)
5872410 .. 5873939
1530 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g09870.t1

Sequence Viewer

Length: 1530 bp
ATGGCACTCTCTCTGTCTCTGATGCCTTCTCCATATCCCGTACGCTTCAAACTTGTTCAGACCCCCTTTTCATACAGAAGCAGATACATAAGAACCCAACAAGGTAGACTACTTACTTCTAAAGCACTTTCATGCTCTGCTACAGAACTTGCTGTTGATAAACGCCTCACATCCTCAAAAGATATTGGCTTTTACTCCCACAGTGAAGAACCCAAGTTGGGTTTTGATGAAATTACTAGTAGGTTGCATGTACAGAGCTTAGTTGAAAGAATTAGAGCTTTGCCCACTAGAGAGACAAGTCAAATTCTTAGTATTTTTGAGCAAGATGGTTGCTTTAAAACCATATCCGAGTTCAATGACATGCTGTTGGCTTTAGCTGTAGCAAAAATGCCTGATGTTGCTTTGAGTTTGTATAGTCAGATATCATCTTACTGTTTAGTTCCTGATTCTTCTACATTTTCTGTCGTGATTACGTGTTACTGTGAGAAAAATGATCTGGATGAGGCCAAGAGGGTTTTAGTCCATATGATTGAAAATGGGTTTAACCCAAGTGTTGCAACAATCACTTTTGTTATAGATTCATTATGCAAAAAGGGTAGATTGCAGAGAGCTTTGGAGGTTTTTGAGGTGATGGGTAGAGTTGGGTCCAAGCCCAGTGTTCAAATGTACAATTGCTTGTTAAAGGGTTTGTGCTATGTGGGGAGAGTGGAGGATGCATATGACATGTTGATGAAGATAAAGAAGGGTGTTATACAACCTGACATTTATACATACACAGCTGTTATGGATGGCTTTTGTAAAGTGGGTCGAACAGATGAGGCGATGGAACTGCTTAATGATGCTGTGGAGTTGGGATTGATACTAGATGTGGTTGCTTTCAACACTTTGTTTGATGGGTACTGCAGGGAGGGTAGGGCAATGGAAGGACTTAATGTGTTGAAGCAGATGAAGGAGAGAAACTGCATCCCTGATTATATCACTTATAGCACATTGATACATGGATTATTGAAATGGGGTAAGACCCGTAATGCGCTAAGAATTTATAAGGAGATGGTAGAAGTTGGTTTTGAAGTGGATGAGAGATTGACAAATGATCTTGTGAGAGGGTTATGCAGGAGATCAACGAAGGAAAAAGACCTGTTGGAAGATGCTTGTGAACTGTTTGAAAAATTGCAGAACGGGGTTTCTGACATAGACGCCAGTACATATGGGCTTATGATCCAAAGTCTTTGCATGGGAAAGAAGATCGATGACGCTATGATCAATCTGAAGCAGATGTTGACAGTGGGTTATTCACCACGGATGATCACCTTTAACAACGTGATTCAATCCCTTTGTGCCGAGGAAAAGATGATTGATGCATTATTAGTTTTAGGTACTGCATATAAATTTGATAGAGTAGCAAGTAGAGTATCTTATAACCTTCTGATTCAAAAGTTGAATCAACATGGCAGTATGCTAGAAGCATGTACTGTATATGGTGCAGCATTGAAGAGAGGTTTAATCCCGAATAAAAAGCCTCAACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_1 PPR_2 PPR_3

Protein Analysis

510

Amino Acids

57.36

Weight (kDa)

8.03

Isoelectric Point (pI)

37.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 145 - 176 9.1e-07 PPR repeat
PPR_2 PF13041 148 - 197 7.8e-11 PPR repeat family
PPR_3 PF13812 172 - 228 3e-06 Pentatricopeptide repeat domain
PPR_1 PF12854 179 - 211 1.3e-06 PPR repeat
PPR_3 PF13812 207 - 263 4.4e-07 Pentatricopeptide repeat domain
PPR_1 PF12854 215 - 243 5.1e-06 PPR repeat
PPR_2 PF13041 218 - 267 4.1e-14 PPR repeat family
PPR_1 PF12854 251 - 280 7.8e-10 PPR repeat
PPR PF01535 256 - 285 1.5e-06 PPR repeat
PPR_3 PF13812 277 - 332 2e-07 Pentatricopeptide repeat domain
PPR_1 PF12854 285 - 317 5.3e-07 PPR repeat
PPR_2 PF13041 289 - 337 1.7e-15 PPR repeat family
PPR PF01535 291 - 321 6.3e-07 PPR repeat
PPR_2 PF13041 323 - 372 8.2e-08 PPR repeat family
PPR PF01535 326 - 356 2.8e-06 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015649)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g09870
malus_domestica MD04G1174700.v1.1
prunus_persica Prupe.6G293600_v2.0.a1
pyrus_communis pycom04g15410
rosa_chinensis RchiOBHm_Chr3g0460471
rosa_laevigata RLG00000025002 RLG00000025008
rosa_multiflora Rmu_co8379257.1_g000001 Rmu_sc0004267.1_g000007
rosa_roxburghii Rroxscaffold_6G00419450
rosa_rugosa Rorug03G0042900
rosa_samantha Rh3AG101000 Rh3BG105000 Rh3CG106800 Rh3DG106300
rosa_wichuraiana Rw3G008590

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1044, 1419
AccI GTMKAC 1 cut(s) 106
AclWI GGATC 1 cut(s) 1213
AcsI RAATTY 3 cut(s) 303, 1038, 1388
AcuI CTGAAG 1 cut(s) 1289
AcyI GRCGYC 1 cut(s) 1197
AfaI GTAC 7 cut(s) 42, 252, 668, 899, 1204, 1378, 1471
AfiI CCNNNNNNNGG 1 cut(s) 218
AflIII ACRYGT 2 cut(s) 473, 723
AhlI ACTAGT 1 cut(s) 236
AluBI AGCT 5 cut(s) 258, 278, 377, 611, 779
AluI AGCT 5 cut(s) 258, 278, 377, 611, 779
Alw26I GTCTC 2 cut(s) 21, 287
AlwI GGATC 1 cut(s) 1213
AoxI GGCC 1 cut(s) 504
ApeKI GCWGC 1 cut(s) 1484
ApoI RAATTY 3 cut(s) 303, 1038, 1388
AspLEI GCGC 1 cut(s) 1033
AspS9I GGNCC 1 cut(s) 645
AsuHPI GGTGA 3 cut(s) 640, 1287, 1300
AvaII GGWCC 1 cut(s) 645
BbvI GCAGC 1 cut(s) 1496
BccI CCATC 6 cut(s) 320, 625, 782, 817, 887, 1045
BcgI CGANNNNNNTGC 2 cut(s) 811, 845
BclI TGATCA 2 cut(s) 1260, 1305
BcoDI GTCTC 2 cut(s) 21, 287
BcuI ACTAGT 1 cut(s) 236
BfaI CTAG 4 cut(s) 237, 288, 863, 1460
BfmI CTRYAG 3 cut(s) 141, 378, 901
BisI GCNGC 1 cut(s) 1485
BlsI GCNGC 1 cut(s) 1486
Bme18I GGWCC 1 cut(s) 645
BmgT120I GGNCC 1 cut(s) 645
BmiI GGNNCC 1 cut(s) 646
BmrI ACTGGG 1 cut(s) 648
BmsI GCATC 6 cut(s) 12, 703, 829, 972, 1138, 1348
BmuI ACTGGG 1 cut(s) 648
Bsa29I ATCGAT 1 cut(s) 1248
BsaAI YACGTR 1 cut(s) 474
BsaHI GRCGYC 1 cut(s) 1197
BsaJI CCNNGG 2 cut(s) 1298, 1341
Bsc4I CCNNNNNNNGG 1 cut(s) 218
Bse1I ACTGG 2 cut(s) 654, 1200
Bse3DI GCAATG 1 cut(s) 924
BseCI ATCGAT 1 cut(s) 1248
BseDI CCNNGG 2 cut(s) 1298, 1341
BseGI GGATG 7 cut(s) 170, 505, 718, 793, 963, 1081, 1308
BseLI CCNNNNNNNGG 1 cut(s) 218
BseMI GCAATG 1 cut(s) 924
BseNI ACTGG 2 cut(s) 654, 1200
BseXI GCAGC 1 cut(s) 1496
BsgI GTGCAG 1 cut(s) 1503
BshFI GGCC 1 cut(s) 506
BshVI ATCGAT 1 cut(s) 1248
BsiWI CGTACG 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 218
BsmAI GTCTC 2 cut(s) 21, 287
BsnI GGCC 1 cut(s) 506
Bsp1407I TGTACA 2 cut(s) 250, 666
Bsp143I GATC 7 cut(s) 493, 1093, 1118, 1218, 1245, 1260, 1305
BspANI GGCC 1 cut(s) 506
BspDI ATCGAT 1 cut(s) 1248
BspLI GGNNCC 1 cut(s) 646
BspMAI CTGCAG 1 cut(s) 905
BspPI GGATC 1 cut(s) 1213
BsrDI GCAATG 1 cut(s) 924
BsrGI TGTACA 2 cut(s) 250, 666
BsrI ACTGG 2 cut(s) 654, 1200
BssECI CCNNGG 2 cut(s) 1298, 1341
BssMI GATC 7 cut(s) 493, 1093, 1118, 1218, 1245, 1260, 1305
BssNI GRCGYC 1 cut(s) 1197
Bst4CI ACNGT 6 cut(s) 203, 434, 482, 1161, 1285, 1474
Bst6I CTCTTC 1 cut(s) 1487
BstACI GRCGYC 1 cut(s) 1197
BstAUI TGTACA 2 cut(s) 250, 666
BstBAI YACGTR 1 cut(s) 474
BstDEI CTNAG 3 cut(s) 259, 308, 1034
BstDSI CCRYGG 1 cut(s) 1298
BstF5I GGATG 7 cut(s) 170, 505, 718, 793, 963, 1081, 1308
BstHHI GCGC 1 cut(s) 1033
BstKTI GATC 7 cut(s) 496, 1096, 1121, 1221, 1248, 1263, 1308
BstMAI GTCTC 2 cut(s) 21, 287
BstMBI GATC 7 cut(s) 493, 1093, 1118, 1218, 1245, 1260, 1305
BstNSI RCATGY 4 cut(s) 251, 364, 727, 1470
BstSFI CTRYAG 3 cut(s) 141, 378, 901
BstV1I GCAGC 1 cut(s) 1496
Bsu15I ATCGAT 1 cut(s) 1248
BsuRI GGCC 1 cut(s) 506
BsuTUI ATCGAT 1 cut(s) 1248
BtgI CCRYGG 1 cut(s) 1298
BtgZI GCGATG 1 cut(s) 836
BtsCI GGATG 7 cut(s) 170, 505, 718, 793, 963, 1081, 1308
BtsIMutI CAGTG 3 cut(s) 208, 661, 1290
CfoI GCGC 1 cut(s) 1033
Cfr13I GGNCC 1 cut(s) 645
ClaI ATCGAT 1 cut(s) 1248
CseI GACGC 2 cut(s) 1205, 1262
Csp6I GTAC 7 cut(s) 41, 251, 667, 898, 1203, 1377, 1470
CviAII CATG 8 cut(s) 132, 248, 361, 724, 998, 1234, 1448, 1467
CviQI GTAC 7 cut(s) 41, 251, 667, 898, 1203, 1377, 1470
DdeI CTNAG 3 cut(s) 259, 308, 1034
DpnI GATC 7 cut(s) 495, 1095, 1120, 1220, 1247, 1262, 1307
DpnII GATC 7 cut(s) 493, 1093, 1118, 1218, 1245, 1260, 1305
DraI TTTAAA 1 cut(s) 337
Eam1104I CTCTTC 1 cut(s) 1487
EarI CTCTTC 1 cut(s) 1487
Eco32I GATATC 1 cut(s) 423
Eco47I GGWCC 1 cut(s) 645
Eco57I CTGAAG 1 cut(s) 1289
EcoRV GATATC 1 cut(s) 423
EcoT22I ATGCAT 2 cut(s) 718, 1363
FaeI CATG 8 cut(s) 135, 251, 364, 727, 1001, 1237, 1451, 1470
FatI CATG 8 cut(s) 131, 247, 360, 723, 997, 1233, 1447, 1466
FauNDI CATATG 3 cut(s) 525, 718, 1207
FbaI TGATCA 2 cut(s) 1260, 1305
FblI GTMKAC 1 cut(s) 106
Fnu4HI GCNGC 1 cut(s) 1485
FokI GGATG 7 cut(s) 157, 512, 725, 800, 950, 1088, 1315
Fsp4HI GCNGC 1 cut(s) 1485
FspBI CTAG 4 cut(s) 237, 288, 863, 1460
GlaI GCGC 1 cut(s) 1032
GluI GCNGC 1 cut(s) 1485
HaeIII GGCC 1 cut(s) 506
HgaI GACGC 2 cut(s) 1205, 1262
HhaI GCGC 1 cut(s) 1033
Hin1I GRCGYC 1 cut(s) 1197
Hin1II CATG 8 cut(s) 135, 251, 364, 727, 1001, 1237, 1451, 1470
Hin6I GCGC 1 cut(s) 1031
HinP1I GCGC 1 cut(s) 1031
HincII GTYRAC 1 cut(s) 1281
HindII GTYRAC 1 cut(s) 1281
HinfI GANTC 5 cut(s) 446, 578, 1324, 1429, 1441
HphI GGTGA 3 cut(s) 640, 1287, 1300
Hpy166II GTNNAC 3 cut(s) 107, 1157, 1281
Hpy188I TCNGA 7 cut(s) 21, 60, 349, 420, 1189, 1269, 1428
Hpy188III TCNNGA 4 cut(s) 443, 466, 497, 1507
Hpy8I GTNNAC 3 cut(s) 107, 1157, 1281
HpyAV CCTTC 6 cut(s) 36, 736, 917, 943, 1120, 1433
HpyCH4III ACNGT 6 cut(s) 203, 434, 482, 1161, 1285, 1474
HpyCH4IV ACGT 2 cut(s) 473, 1320
HpyF3I CTNAG 3 cut(s) 259, 308, 1034
HpySE526I ACGT 2 cut(s) 473, 1320
Hsp92I GRCGYC 1 cut(s) 1197
Hsp92II CATG 8 cut(s) 135, 251, 364, 727, 1001, 1237, 1451, 1470
HspAI GCGC 1 cut(s) 1031
Ksp22I TGATCA 2 cut(s) 1260, 1305
Kzo9I GATC 7 cut(s) 493, 1093, 1118, 1218, 1245, 1260, 1305
Lsp1109I GCAGC 1 cut(s) 1496
LweI GCATC 6 cut(s) 12, 703, 829, 972, 1138, 1348
MaeI CTAG 4 cut(s) 237, 288, 863, 1460
MaeII ACGT 2 cut(s) 473, 1320
MaeIII GTNAC 1 cut(s) 476
MalI GATC 7 cut(s) 495, 1095, 1120, 1220, 1247, 1262, 1307
MboI GATC 7 cut(s) 493, 1093, 1118, 1218, 1245, 1260, 1305
MboII GAAGA 6 cut(s) 218, 441, 745, 1157, 1255, 1504
MfeI CAATTG 1 cut(s) 670
MluCI AATT 7 cut(s) 231, 270, 303, 670, 1038, 1169, 1388
MmeI TCCRAC 1 cut(s) 1122
Mph1103I ATGCAT 2 cut(s) 718, 1363
MseI TTAA 7 cut(s) 336, 543, 680, 834, 930, 1314, 1502
MslI CAYNNNNRTG 2 cut(s) 130, 728
MspA1I CMGCKG 1 cut(s) 779
MunI CAATTG 1 cut(s) 670
NdeI CATATG 3 cut(s) 525, 718, 1207
NdeII GATC 7 cut(s) 493, 1093, 1118, 1218, 1245, 1260, 1305
NlaIII CATG 8 cut(s) 135, 251, 364, 727, 1001, 1237, 1451, 1470
NlaIV GGNNCC 1 cut(s) 646
NmeAIII GCCGAG 1 cut(s) 1366
NsiI ATGCAT 2 cut(s) 718, 1363
NspI RCATGY 4 cut(s) 251, 364, 727, 1470
PciI ACATGT 1 cut(s) 723
PfeI GAWTC 5 cut(s) 446, 578, 1324, 1429, 1441
Pfl23II CGTACG 1 cut(s) 40
PkrI GCNGC 1 cut(s) 1486
Ppu21I YACGTR 1 cut(s) 474
PscI ACATGT 1 cut(s) 723
PsiI TTATAA 2 cut(s) 1044, 1419
PspLI CGTACG 1 cut(s) 40
PspN4I GGNNCC 1 cut(s) 646
PspPI GGNCC 1 cut(s) 645
PstI CTGCAG 1 cut(s) 905
PvuII CAGCTG 1 cut(s) 779
RsaI GTAC 7 cut(s) 42, 252, 668, 899, 1204, 1378, 1471
RsaNI GTAC 7 cut(s) 41, 251, 667, 898, 1203, 1377, 1470
RseI CAYNNNNRTG 2 cut(s) 130, 728
SaqAI TTAA 7 cut(s) 336, 543, 680, 834, 930, 1314, 1502
SatI GCNGC 1 cut(s) 1485
Sau3AI GATC 7 cut(s) 493, 1093, 1118, 1218, 1245, 1260, 1305
Sau96I GGNCC 1 cut(s) 645
SfaNI GCATC 6 cut(s) 12, 703, 829, 972, 1138, 1348
SfcI CTRYAG 3 cut(s) 141, 378, 901
SinI GGWCC 1 cut(s) 645
SmiMI CAYNNNNRTG 2 cut(s) 130, 728
SpeI ACTAGT 1 cut(s) 236
Sse9I AATT 7 cut(s) 231, 270, 303, 670, 1038, 1169, 1388
SspMI CTAG 4 cut(s) 237, 288, 863, 1460
TaaI ACNGT 6 cut(s) 203, 434, 482, 1161, 1285, 1474
TaiI ACGT 2 cut(s) 476, 1323
TaqI TCGA 2 cut(s) 808, 1248
TasI AATT 7 cut(s) 231, 270, 303, 670, 1038, 1169, 1388
TatI WGTACW 4 cut(s) 250, 666, 1202, 1469
TfiI GAWTC 5 cut(s) 446, 578, 1324, 1429, 1441
Tru1I TTAA 7 cut(s) 336, 543, 680, 834, 930, 1314, 1502
Tru9I TTAA 7 cut(s) 336, 543, 680, 834, 930, 1314, 1502
TscAI CASTG 3 cut(s) 208, 661, 1290
TseI GCWGC 1 cut(s) 1484
TspDTI ATGAA 6 cut(s) 60, 120, 243, 570, 746, 962
TspGWI ACGGA 1 cut(s) 1315
TspRI CASTG 3 cut(s) 208, 661, 1290
VpaK11BI GGWCC 1 cut(s) 645
XapI RAATTY 3 cut(s) 303, 1038, 1388
XceI RCATGY 4 cut(s) 251, 364, 727, 1470
XmiI GTMKAC 1 cut(s) 106
XspI CTAG 4 cut(s) 237, 288, 863, 1460
Zsp2I ATGCAT 2 cut(s) 718, 1363
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.