Rmu_sc0004267.1_g000007

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004267.1
Physical Location & Seq
Reverse (-)
34887 .. 37191
2305 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004267.1_g000007.1.cds

Sequence Viewer

Length: 1590 bp
atggacctctctctgtctctgatgccttccccatatcctgtaagcttcaaacttgttcagactccctctccatacagaagcagatacataagaacccaacaaggtaagctacttattttcacaacactttcatgctctgctagaaatcttgctgataaaacacaccagacatccccaaaagattatggctgtcactcccatagtgaagaacccaagttgggttttgatgaaattactagtagattgcatgtacagagtttagttgacagaattagagctttgcacactggagagacaagtgaaattcttagtatttttgagcaagatggttgctttagaaccatttctgagttcaatgatctgctcatggctttagttgtagcgaaagagtttgatattgctttgagcttgtatgatgaaatatcatcttactgtttagttcctgattcttccacattttctattgtgattacctgttactgtgagaaaaatgatctggatgaggccaagagggttttagtccatatgattgaaaatgggtttaacccaagtgttgcaacaatgacttttgtgatagattcattatgcaaaaagggtagattgcagagagctttggaggtttttgaggtgatgggtagagttgggtccaagcccactgttcaaatgtacaattgcttgttaaagggtttgtgctatgtgggaagagtggaggatgcatatgaaatgttgatgaagataaagaagggtgttgtagaacctgacatttttacatacacagctgttatggatggtttttgtaaagtgggtcgcacagatgaggcgatggaactgcttaatgaagctgtggagttgggattaataccagatgtggttgctttcaatactctgtttgatgggtactgcagggagggtagggcaatggagggacttaatgtgttgaagcagatgaaggagagaaactgcatccctgattatattacttatagcacattgttacatggattgttgaaatggggtaagacccgtaatgcactaaggatttacaaggagatggtggaaattggtttcgaagtggatgagagattgacgaatgctcttgtgagagggttatgcaggagatcatcgaaggaaaaagacctgttggaagatgcctgtaaactgtttgaaaaattgcagaatggggtttttgacatagaagctagtacatatgggcttatgatccaaagtctttgcatggaaaagaagattgatgacgctatgatcaatttgaagcagatgatggcagtgggttattcaccatggatgatcacctttaacaaagtgattcaaaccctctgttctgaggacaagatgattgatgcattattagttttaggtactgcgaacattgtggttaactccaatcctgtgttcagtgctgatgtgcttcaagtgattactatgcaaatgattgaagaatttagagctgcacgacgtggaacctttgcaaatccgcagcttgacttaggagcctatgccttcaccttttgtcaaaaactcaacgcggatggtctggatggtgctgagctagaaaagtatattgtggagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

529

Amino Acids

59.72

Weight (kDa)

5.27

Isoelectric Point (pI)

36.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015649)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 1544
AciI CCGC 2 cut(s) 1493, 1544
AclWI GGATC 1 cut(s) 1213
AcsI RAATTY 2 cut(s) 303, 1457
AdeI CACNNNGTG 1 cut(s) 1475
AfaI GTAC 5 cut(s) 252, 668, 899, 1204, 1378
AfiI CCNNNNNNNGG 1 cut(s) 218
AhlI ACTAGT 1 cut(s) 236
AjiI CACGTC 1 cut(s) 1475
AjuI GAANNNNNNNTTGG 2 cut(s) 1394, 1426
Alw26I GTCTC 2 cut(s) 21, 287
AlwI GGATC 1 cut(s) 1213
AoxI GGCC 1 cut(s) 504
ApeKI GCWGC 2 cut(s) 1466, 1495
ApoI RAATTY 2 cut(s) 303, 1457
AseI ATTAAT 1 cut(s) 857
Asp700I GAANNNNTTC 1 cut(s) 343
AspS9I GGNCC 2 cut(s) 4, 645
AsuHPI GGTGA 4 cut(s) 640, 1287, 1300, 1513
AsuII TTCGAA 1 cut(s) 1068
AvaII GGWCC 2 cut(s) 4, 645
BbvI GCAGC 2 cut(s) 1453, 1507
BccI CCATC 9 cut(s) 320, 625, 782, 817, 887, 1045, 1273, 1541, 1550
BcgI CGANNNNNNTGC 2 cut(s) 811, 845
BclI TGATCA 2 cut(s) 1260, 1305
BcoDI GTCTC 2 cut(s) 21, 287
BcuI ACTAGT 1 cut(s) 236
BfaI CTAG 4 cut(s) 141, 237, 1200, 1568
BfmI CTRYAG 1 cut(s) 901
BisI GCNGC 2 cut(s) 1467, 1496
BlpI GCTNAGC 1 cut(s) 1563
BlsI GCNGC 2 cut(s) 1468, 1497
Bme18I GGWCC 2 cut(s) 4, 645
BmgBI CACGTC 1 cut(s) 1475
BmgT120I GGNCC 2 cut(s) 4, 645
BmiI GGNNCC 3 cut(s) 646, 1480, 1510
BmsI GCATC 5 cut(s) 12, 703, 972, 1138, 1348
BpmI CTGGAG 1 cut(s) 309
Bpu1102I GCTNAGC 1 cut(s) 1563
Bpu14I TTCGAA 1 cut(s) 1068
BsaJI CCNNGG 1 cut(s) 1298
BsaXI ACNNNNNCTCC 2 cut(s) 52, 82
Bsc4I CCNNNNNNNGG 1 cut(s) 218
Bse1I ACTGG 1 cut(s) 292
Bse3DI GCAATG 1 cut(s) 924
BseDI CCNNGG 1 cut(s) 1298
BseGI GGATG 9 cut(s) 170, 505, 718, 793, 963, 1081, 1308, 1552, 1561
BseLI CCNNNNNNNGG 1 cut(s) 218
BseMI GCAATG 1 cut(s) 924
BseMII CTCAG 3 cut(s) 339, 1332, 1554
BseNI ACTGG 1 cut(s) 292
BseXI GCAGC 2 cut(s) 1453, 1507
BsgI GTGCAG 1 cut(s) 1452
Bsh1236I CGCG 1 cut(s) 1544
BshFI GGCC 1 cut(s) 506
BslFI GGGAC 1 cut(s) 939
BslI CCNNNNNNNGG 1 cut(s) 218
BsmAI GTCTC 2 cut(s) 21, 287
BsmFI GGGAC 1 cut(s) 939
BsmI GAATGC 1 cut(s) 1096
BsnI GGCC 1 cut(s) 506
Bsp119I TTCGAA 1 cut(s) 1068
Bsp1407I TGTACA 2 cut(s) 250, 666
Bsp143I GATC 6 cut(s) 358, 493, 1118, 1218, 1260, 1305
Bsp1720I GCTNAGC 1 cut(s) 1563
Bsp19I CCATGG 1 cut(s) 1298
BspACI CCGC 2 cut(s) 1493, 1544
BspANI GGCC 1 cut(s) 506
BspCNI CTCAG 3 cut(s) 340, 1333, 1555
BspFNI CGCG 1 cut(s) 1544
BspLI GGNNCC 3 cut(s) 646, 1480, 1510
BspMAI CTGCAG 1 cut(s) 905
BspPI GGATC 1 cut(s) 1213
BspT104I TTCGAA 1 cut(s) 1068
BsrDI GCAATG 1 cut(s) 924
BsrGI TGTACA 2 cut(s) 250, 666
BsrI ACTGG 1 cut(s) 292
BssECI CCNNGG 1 cut(s) 1298
BssMI GATC 6 cut(s) 358, 493, 1118, 1218, 1260, 1305
BssT1I CCWWGG 1 cut(s) 1298
Bst4CI ACNGT 4 cut(s) 434, 482, 658, 1161
Bst6I CTCTTC 1 cut(s) 697
BstAUI TGTACA 2 cut(s) 250, 666
BstBI TTCGAA 1 cut(s) 1068
BstDEI CTNAG 6 cut(s) 308, 348, 1034, 1341, 1504, 1563
BstDSI CCRYGG 1 cut(s) 1298
BstF5I GGATG 9 cut(s) 170, 505, 718, 793, 963, 1081, 1308, 1552, 1561
BstFNI CGCG 1 cut(s) 1544
BstKTI GATC 6 cut(s) 361, 496, 1121, 1221, 1263, 1308
BstMAI GTCTC 2 cut(s) 21, 287
BstMBI GATC 6 cut(s) 358, 493, 1118, 1218, 1260, 1305
BstNSI RCATGY 1 cut(s) 251
BstSFI CTRYAG 1 cut(s) 901
BstUI CGCG 1 cut(s) 1544
BstV1I GCAGC 2 cut(s) 1453, 1507
BsuRI GGCC 1 cut(s) 506
BtgI CCRYGG 1 cut(s) 1298
BtgZI GCGATG 1 cut(s) 836
BtrI CACGTC 1 cut(s) 1475
BtsCI GGATG 9 cut(s) 170, 505, 718, 793, 963, 1081, 1308, 1552, 1561
BtsI GCAGTG 1 cut(s) 1290
BtsIMutI CAGTG 4 cut(s) 285, 654, 1290, 1420
Cfr13I GGNCC 2 cut(s) 4, 645
CseI GACGC 1 cut(s) 1262
Csp6I GTAC 5 cut(s) 251, 667, 898, 1203, 1377
CviAII CATG 6 cut(s) 132, 248, 367, 998, 1234, 1299
CviQI GTAC 5 cut(s) 251, 667, 898, 1203, 1377
DdeI CTNAG 6 cut(s) 308, 348, 1034, 1341, 1504, 1563
DpnI GATC 6 cut(s) 360, 495, 1120, 1220, 1262, 1307
DpnII GATC 6 cut(s) 358, 493, 1118, 1218, 1260, 1305
DraIII CACNNNGTG 1 cut(s) 1475
Eam1104I CTCTTC 1 cut(s) 697
EarI CTCTTC 1 cut(s) 697
Eco130I CCWWGG 1 cut(s) 1298
Eco47I GGWCC 2 cut(s) 4, 645
EcoT14I CCWWGG 1 cut(s) 1298
EcoT22I ATGCAT 2 cut(s) 718, 1363
ErhI CCWWGG 1 cut(s) 1298
FaeI CATG 6 cut(s) 135, 251, 370, 1001, 1237, 1302
FaqI GGGAC 1 cut(s) 939
FatI CATG 6 cut(s) 131, 247, 366, 997, 1233, 1298
FauNDI CATATG 3 cut(s) 525, 718, 1207
FbaI TGATCA 2 cut(s) 1260, 1305
Fnu4HI GCNGC 2 cut(s) 1467, 1496
FokI GGATG 9 cut(s) 157, 512, 725, 800, 950, 1088, 1315, 1559, 1568
Fsp4HI GCNGC 2 cut(s) 1467, 1496
FspBI CTAG 4 cut(s) 141, 237, 1200, 1568
GluI GCNGC 2 cut(s) 1467, 1496
GsuI CTGGAG 1 cut(s) 309
HaeIII GGCC 1 cut(s) 506
HgaI GACGC 1 cut(s) 1262
Hin1II CATG 6 cut(s) 135, 251, 370, 1001, 1237, 1302
HincII GTYRAC 2 cut(s) 265, 1396
HindII GTYRAC 2 cut(s) 265, 1396
HindIII AAGCTT 1 cut(s) 43
HinfI GANTC 4 cut(s) 61, 446, 578, 1324
HpaI GTTAAC 1 cut(s) 1396
HphI GGTGA 4 cut(s) 640, 1287, 1300, 1513
Hpy166II GTNNAC 3 cut(s) 265, 1157, 1396
Hpy188I TCNGA 4 cut(s) 21, 60, 349, 1342
Hpy188III TCNNGA 3 cut(s) 443, 497, 1553
Hpy8I GTNNAC 3 cut(s) 265, 1157, 1396
Hpy99I CGWCG 1 cut(s) 1476
HpyAV CCTTC 5 cut(s) 36, 736, 943, 1120, 1528
HpyCH4III ACNGT 4 cut(s) 434, 482, 658, 1161
HpyCH4IV ACGT 1 cut(s) 1474
HpyF3I CTNAG 6 cut(s) 308, 348, 1034, 1341, 1504, 1563
HpySE526I ACGT 1 cut(s) 1474
Hsp92II CATG 6 cut(s) 135, 251, 370, 1001, 1237, 1302
Ksp22I TGATCA 2 cut(s) 1260, 1305
KspAI GTTAAC 1 cut(s) 1396
Kzo9I GATC 6 cut(s) 358, 493, 1118, 1218, 1260, 1305
LmnI GCTCC 1 cut(s) 1508
Lsp1109I GCAGC 2 cut(s) 1453, 1507
LweI GCATC 5 cut(s) 12, 703, 972, 1138, 1348
MaeI CTAG 4 cut(s) 141, 237, 1200, 1568
MaeII ACGT 1 cut(s) 1474
MaeIII GTNAC 3 cut(s) 191, 476, 993
MalI GATC 6 cut(s) 360, 495, 1120, 1220, 1262, 1307
MboI GATC 6 cut(s) 358, 493, 1118, 1218, 1260, 1305
MboII GAAGA 7 cut(s) 218, 441, 714, 745, 1157, 1255, 1466
MfeI CAATTG 1 cut(s) 670
MluCI AATT 8 cut(s) 231, 270, 303, 670, 1059, 1169, 1264, 1457
MlyI GAGTC 1 cut(s) 55
MmeI TCCRAC 1 cut(s) 1122
Mph1103I ATGCAT 2 cut(s) 718, 1363
MroXI GAANNNNTTC 1 cut(s) 343
MseI TTAA 7 cut(s) 543, 680, 834, 857, 930, 1314, 1395
MslI CAYNNNNRTG 1 cut(s) 130
MspA1I CMGCKG 1 cut(s) 779
MunI CAATTG 1 cut(s) 670
Mva1269I GAATGC 1 cut(s) 1096
MvnI CGCG 1 cut(s) 1544
NcoI CCATGG 1 cut(s) 1298
NdeI CATATG 3 cut(s) 525, 718, 1207
NdeII GATC 6 cut(s) 358, 493, 1118, 1218, 1260, 1305
NlaIII CATG 6 cut(s) 135, 251, 370, 1001, 1237, 1302
NlaIV GGNNCC 3 cut(s) 646, 1480, 1510
NmuCI GTSAC 1 cut(s) 191
NsiI ATGCAT 2 cut(s) 718, 1363
NspI RCATGY 1 cut(s) 251
NspV TTCGAA 1 cut(s) 1068
PctI GAATGC 1 cut(s) 1096
PdmI GAANNNNTTC 1 cut(s) 343
PfeI GAWTC 3 cut(s) 446, 578, 1324
PkrI GCNGC 2 cut(s) 1468, 1497
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
PshBI ATTAAT 1 cut(s) 857
PspN4I GGNNCC 3 cut(s) 646, 1480, 1510
PspPI GGNCC 2 cut(s) 4, 645
PstI CTGCAG 1 cut(s) 905
PvuII CAGCTG 1 cut(s) 779
RsaI GTAC 5 cut(s) 252, 668, 899, 1204, 1378
RsaNI GTAC 5 cut(s) 251, 667, 898, 1203, 1377
RseI CAYNNNNRTG 1 cut(s) 130
SaqAI TTAA 7 cut(s) 543, 680, 834, 857, 930, 1314, 1395
SatI GCNGC 2 cut(s) 1467, 1496
Sau3AI GATC 6 cut(s) 358, 493, 1118, 1218, 1260, 1305
Sau96I GGNCC 2 cut(s) 4, 645
SchI GAGTC 1 cut(s) 55
SfaNI GCATC 5 cut(s) 12, 703, 972, 1138, 1348
SfcI CTRYAG 1 cut(s) 901
SfuI TTCGAA 1 cut(s) 1068
SinI GGWCC 2 cut(s) 4, 645
SmiMI CAYNNNNRTG 1 cut(s) 130
SpeI ACTAGT 1 cut(s) 236
Sse9I AATT 8 cut(s) 231, 270, 303, 670, 1059, 1169, 1264, 1457
SsiI CCGC 2 cut(s) 1493, 1544
SspMI CTAG 4 cut(s) 141, 237, 1200, 1568
StyI CCWWGG 1 cut(s) 1298
TaaI ACNGT 4 cut(s) 434, 482, 658, 1161
TaiI ACGT 1 cut(s) 1477
TaqI TCGA 2 cut(s) 1068, 1124
TasI AATT 8 cut(s) 231, 270, 303, 670, 1059, 1169, 1264, 1457
TatI WGTACW 3 cut(s) 250, 666, 1202
TfiI GAWTC 3 cut(s) 446, 578, 1324
Tru1I TTAA 7 cut(s) 543, 680, 834, 857, 930, 1314, 1395
Tru9I TTAA 7 cut(s) 543, 680, 834, 857, 930, 1314, 1395
TscAI CASTG 4 cut(s) 292, 661, 1290, 1420
TseFI GTSAC 1 cut(s) 191
TseI GCWGC 2 cut(s) 1466, 1495
Tsp45I GTSAC 1 cut(s) 191
TspDTI ATGAA 8 cut(s) 120, 243, 432, 570, 735, 746, 852, 962
TspRI CASTG 4 cut(s) 292, 661, 1290, 1420
VpaK11BI GGWCC 2 cut(s) 4, 645
VspI ATTAAT 1 cut(s) 857
XapI RAATTY 2 cut(s) 303, 1457
XceI RCATGY 1 cut(s) 251
XmnI GAANNNNTTC 1 cut(s) 343
XspI CTAG 4 cut(s) 141, 237, 1200, 1568
Zsp2I ATGCAT 2 cut(s) 718, 1363
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.