Rh3BG105000

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
8391888 .. 8394181
2294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG105000.1

Sequence Viewer

Length: 899 bp
ATGGACCTCTCTCTGTCTCTGATGCCTTCCCCATATCCTGTAAGCTTCAAACTTGTTCAGACTCCCTCTCCATACAGAAGCAGATACATAAGAACCCAACAAGGTAAGCTACTTATTTTCACAACACTTTCATGCTCTGCTAGAAATCTTGCTGATAAAACACACCAGACATCCCCAAAAGATTATGGCTGTCACTCCCATAGTGAAGAACCCAAGTTGGGTTTTGATGAAATTACTAGTAGATTGCATGTACAGAGTTTAGTTGACAGAATTAGAGCTTTGCACACTGGAGAGACAAGTGAAATTCTTAGTATTTTTGAGCAAGATGGTTGCTTTAGAACCATTTCTGAGTTCAATGATCTGCTCATGGCTTTAGTTGTAGCGAAAGAGTTTGATATTGCTTTGAGCTTGTATGATGAAATATCATCTTACTGTTTAGTTCCTGATTCTTCCACATTTTCTATTGTGATTACCTGTTACTGTGAGAAAAATGATCTGGATGAGGCCAAGAGGGTTTTAGTCCATATGATTGAAAATGGGTTTAACCCAAGTGTTGCAACAATGACTTTTGTGATAGATTCATTATGCAAAAAGGGTAGATTGCAGAGAGCTTTGGAGGTTTTTGAGGTGATGGGTAGAGTTGGGTCCAAGCCCACTGTTCAAATGTACAATTGCTTGTTAAAGGGTTTGTGCTATGTGGGAAGAGTGGAGGATGCATATGAAATGTTGATGAAGATAAAGAAGGGTGTTGTAGAACCTGACATTTTTACATACACAGCTGTTATGGATGGTTTTTGTAAAGTGGGTCGCACAGATGAGGCGATGGAACTGCTTAATGAAGCTGTGGAGTTGGGATTAATACCAGATGTGGTTGCTTTCAATACTCTGTTTGATGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

299

Amino Acids

33.59

Weight (kDa)

5.16

Isoelectric Point (pI)

36.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 145 - 176 5.9e-08 PPR repeat
PPR_2 PF13041 148 - 197 1.5e-11 PPR repeat family
PPR_long PF17177 167 - 280 2.3e-06 Pentacotripeptide-repeat region of PRORP
PPR_3 PF13812 172 - 228 3.7e-07 Pentatricopeptide repeat domain
PPR_1 PF12854 179 - 211 4.2e-07 PPR repeat
PPR_2 PF13041 183 - 231 2.8e-11 PPR repeat family
PPR_1 PF12854 215 - 243 4.3e-07 PPR repeat
PPR_3 PF13812 215 - 262 4.2e-06 Pentatricopeptide repeat domain
PPR_2 PF13041 218 - 267 5.7e-14 PPR repeat family
PPR_1 PF12854 251 - 280 6.8e-11 PPR repeat
PPR_2 PF13041 253 - 299 7.2e-13 PPR repeat family
PPR PF01535 256 - 286 1.8e-07 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015649)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 303
AfaI GTAC 2 cut(s) 252, 668
AfiI CCNNNNNNNGG 1 cut(s) 218
AgsI TTSAA 5 cut(s) 49, 355, 533, 662, 880
AhlI ACTAGT 1 cut(s) 236
AluBI AGCT 7 cut(s) 45, 109, 278, 408, 611, 779, 842
AluI AGCT 7 cut(s) 45, 109, 278, 408, 611, 779, 842
Alw26I GTCTC 2 cut(s) 21, 287
AoxI GGCC 1 cut(s) 504
ApoI RAATTY 1 cut(s) 303
AseI ATTAAT 1 cut(s) 857
Asp700I GAANNNNTTC 1 cut(s) 343
AspS9I GGNCC 2 cut(s) 4, 645
AsuHPI GGTGA 1 cut(s) 640
AvaII GGWCC 2 cut(s) 4, 645
BccI CCATC 5 cut(s) 320, 625, 782, 817, 887
BcgI CGANNNNNNTGC 2 cut(s) 811, 845
BcoDI GTCTC 2 cut(s) 21, 287
BcuI ACTAGT 1 cut(s) 236
BfaI CTAG 2 cut(s) 141, 237
Bme18I GGWCC 2 cut(s) 4, 645
BmgT120I GGNCC 2 cut(s) 4, 645
BmiI GGNNCC 1 cut(s) 646
BmsI GCATC 2 cut(s) 12, 703
BpmI CTGGAG 1 cut(s) 309
BsaXI ACNNNNNCTCC 2 cut(s) 52, 82
Bsc4I CCNNNNNNNGG 1 cut(s) 218
Bse1I ACTGG 1 cut(s) 292
BseGI GGATG 4 cut(s) 170, 505, 718, 793
BseLI CCNNNNNNNGG 1 cut(s) 218
BseMII CTCAG 1 cut(s) 339
BseNI ACTGG 1 cut(s) 292
BshFI GGCC 1 cut(s) 506
BslI CCNNNNNNNGG 1 cut(s) 218
BsmAI GTCTC 2 cut(s) 21, 287
BsnI GGCC 1 cut(s) 506
Bsp1407I TGTACA 2 cut(s) 250, 666
Bsp143I GATC 2 cut(s) 358, 493
BspANI GGCC 1 cut(s) 506
BspCNI CTCAG 1 cut(s) 340
BspLI GGNNCC 1 cut(s) 646
BsrGI TGTACA 2 cut(s) 250, 666
BsrI ACTGG 1 cut(s) 292
BssMI GATC 2 cut(s) 358, 493
Bst4CI ACNGT 3 cut(s) 434, 482, 658
Bst6I CTCTTC 1 cut(s) 697
BstAUI TGTACA 2 cut(s) 250, 666
BstDEI CTNAG 2 cut(s) 308, 348
BstF5I GGATG 4 cut(s) 170, 505, 718, 793
BstKTI GATC 2 cut(s) 361, 496
BstMAI GTCTC 2 cut(s) 21, 287
BstMBI GATC 2 cut(s) 358, 493
BstNSI RCATGY 1 cut(s) 251
BsuRI GGCC 1 cut(s) 506
BtgZI GCGATG 1 cut(s) 836
BtsCI GGATG 4 cut(s) 170, 505, 718, 793
BtsIMutI CAGTG 2 cut(s) 285, 654
Cfr13I GGNCC 2 cut(s) 4, 645
Csp6I GTAC 2 cut(s) 251, 667
CviAII CATG 3 cut(s) 132, 248, 367
CviQI GTAC 2 cut(s) 251, 667
DdeI CTNAG 2 cut(s) 308, 348
DpnI GATC 2 cut(s) 360, 495
DpnII GATC 2 cut(s) 358, 493
Eam1104I CTCTTC 1 cut(s) 697
EarI CTCTTC 1 cut(s) 697
Eco47I GGWCC 2 cut(s) 4, 645
EcoT22I ATGCAT 1 cut(s) 718
FaeI CATG 3 cut(s) 135, 251, 370
FatI CATG 3 cut(s) 131, 247, 366
FauNDI CATATG 2 cut(s) 525, 718
FokI GGATG 4 cut(s) 157, 512, 725, 800
FspBI CTAG 2 cut(s) 141, 237
GsuI CTGGAG 1 cut(s) 309
HaeIII GGCC 1 cut(s) 506
Hin1II CATG 3 cut(s) 135, 251, 370
HincII GTYRAC 1 cut(s) 265
HindII GTYRAC 1 cut(s) 265
HindIII AAGCTT 1 cut(s) 43
HinfI GANTC 3 cut(s) 61, 446, 578
HphI GGTGA 1 cut(s) 640
Hpy166II GTNNAC 1 cut(s) 265
Hpy188I TCNGA 3 cut(s) 21, 60, 349
Hpy188III TCNNGA 2 cut(s) 443, 497
Hpy8I GTNNAC 1 cut(s) 265
HpyAV CCTTC 2 cut(s) 36, 736
HpyCH4III ACNGT 3 cut(s) 434, 482, 658
HpyCH4V TGCA 6 cut(s) 247, 283, 557, 588, 604, 716
HpyF3I CTNAG 2 cut(s) 308, 348
Hsp92II CATG 3 cut(s) 135, 251, 370
Kzo9I GATC 2 cut(s) 358, 493
LpnPI CCDG 8 cut(s) 51, 179, 273, 456, 482, 487, 771, 876
LweI GCATC 2 cut(s) 12, 703
MaeI CTAG 2 cut(s) 141, 237
MaeIII GTNAC 2 cut(s) 191, 476
MalI GATC 2 cut(s) 360, 495
MboI GATC 2 cut(s) 358, 493
MboII GAAGA 4 cut(s) 218, 441, 714, 745
MfeI CAATTG 1 cut(s) 670
MluCI AATT 4 cut(s) 231, 270, 303, 670
MlyI GAGTC 1 cut(s) 55
MnlI CCTC 8 cut(s) 17, 76, 496, 504, 610, 619, 703, 811
Mph1103I ATGCAT 1 cut(s) 718
MroXI GAANNNNTTC 1 cut(s) 343
MseI TTAA 4 cut(s) 543, 680, 834, 857
MslI CAYNNNNRTG 1 cut(s) 130
MspA1I CMGCKG 1 cut(s) 779
MunI CAATTG 1 cut(s) 670
NdeI CATATG 2 cut(s) 525, 718
NdeII GATC 2 cut(s) 358, 493
NlaIII CATG 3 cut(s) 135, 251, 370
NlaIV GGNNCC 1 cut(s) 646
NmuCI GTSAC 1 cut(s) 191
NsiI ATGCAT 1 cut(s) 718
NspI RCATGY 1 cut(s) 251
PdmI GAANNNNTTC 1 cut(s) 343
PfeI GAWTC 2 cut(s) 446, 578
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
PshBI ATTAAT 1 cut(s) 857
PspN4I GGNNCC 1 cut(s) 646
PspPI GGNCC 2 cut(s) 4, 645
PvuII CAGCTG 1 cut(s) 779
RsaI GTAC 2 cut(s) 252, 668
RsaNI GTAC 2 cut(s) 251, 667
RseI CAYNNNNRTG 1 cut(s) 130
SaqAI TTAA 4 cut(s) 543, 680, 834, 857
Sau3AI GATC 2 cut(s) 358, 493
Sau96I GGNCC 2 cut(s) 4, 645
SchI GAGTC 1 cut(s) 55
SfaNI GCATC 2 cut(s) 12, 703
SinI GGWCC 2 cut(s) 4, 645
SmiMI CAYNNNNRTG 1 cut(s) 130
SpeI ACTAGT 1 cut(s) 236
Sse9I AATT 4 cut(s) 231, 270, 303, 670
SspMI CTAG 2 cut(s) 141, 237
TaaI ACNGT 3 cut(s) 434, 482, 658
TasI AATT 4 cut(s) 231, 270, 303, 670
TatI WGTACW 2 cut(s) 250, 666
TfiI GAWTC 2 cut(s) 446, 578
Tru1I TTAA 4 cut(s) 543, 680, 834, 857
Tru9I TTAA 4 cut(s) 543, 680, 834, 857
TscAI CASTG 2 cut(s) 292, 661
TseFI GTSAC 1 cut(s) 191
Tsp45I GTSAC 1 cut(s) 191
TspDTI ATGAA 7 cut(s) 120, 243, 432, 570, 735, 746, 852
TspRI CASTG 2 cut(s) 292, 661
VpaK11BI GGWCC 2 cut(s) 4, 645
VspI ATTAAT 1 cut(s) 857
XapI RAATTY 1 cut(s) 303
XceI RCATGY 1 cut(s) 251
XmnI GAANNNNTTC 1 cut(s) 343
XspI CTAG 2 cut(s) 141, 237
Zsp2I ATGCAT 1 cut(s) 718
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.