FvH4_6g12730

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Reverse (-)
7700086 .. 7701326
1241 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g12730.t1

Sequence Viewer

Length: 261 bp
ATGGGTGTCTCCAATTCCAGTAGCTCTTTGCTAGCTTTGGTGCTTCTTCTAGTTGCTTGTGCTTCTGAGAAGTCTTTAGCTGTTGATGCTAGGCCACTTTCCCTCTTTTCACAGCAAGGATATTCAAAGGTTTTTGGAACCCTTGGGATAGCTTGCGAGTGTTGTGATGCAGCTGGAGGTGAATGCAAAAGTAGTTGGACTGGTTCTTGCAGTAGCCTCAAATGTCTTCCTTGGAAGCAACATAATTTGAAGCTAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

8.97

Weight (kDa)

8.2

Isoelectric Point (pI)

55.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017326)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g12730
malus_domestica MD04G1138900.v1.1 MD12G1154700.v1.1
prunus_persica Prupe.6G264500_v2.0.a1
pyrus_communis pycom04g12690 pycom12g14690
rosa_chinensis RchiOBHm_Chr3g0464651
rosa_roxburghii Rroxscaffold_6G00415490
rosa_rugosa Rorug03G0073500
rosa_samantha Rh3BG135800 Rh3CG138400 Rh3DG137400
rosa_wichuraiana Rw3G011120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 126, 250
AluBI AGCT 6 cut(s) 24, 35, 80, 152, 173, 253
AluI AGCT 6 cut(s) 24, 35, 80, 152, 173, 253
Alw26I GTCTC 1 cut(s) 13
AoxI GGCC 1 cut(s) 92
ApeKI GCWGC 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 191
AsuNHI GCTAGC 1 cut(s) 31
BbsI GAAGAC 1 cut(s) 218
BbvI GCAGC 1 cut(s) 182
BcoDI GTCTC 1 cut(s) 13
BfaI CTAG 3 cut(s) 32, 50, 90
BisI GCNGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 172
BmiI GGNNCC 1 cut(s) 139
BmsI GCATC 2 cut(s) 76, 157
BmtI GCTAGC 1 cut(s) 35
BpiI GAAGAC 1 cut(s) 218
BpmI CTGGAG 1 cut(s) 195
BsaJI CCNNGG 2 cut(s) 142, 230
Bse1I ACTGG 2 cut(s) 18, 205
BseDI CCNNGG 2 cut(s) 142, 230
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 2 cut(s) 18, 205
BseXI GCAGC 1 cut(s) 182
BshFI GGCC 1 cut(s) 94
BsmAI GTCTC 1 cut(s) 13
BsmI GAATGC 1 cut(s) 188
BsnI GGCC 1 cut(s) 94
BspANI GGCC 1 cut(s) 94
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 139
BspOI GCTAGC 1 cut(s) 35
BsrI ACTGG 2 cut(s) 18, 205
BssECI CCNNGG 2 cut(s) 142, 230
BssT1I CCWWGG 2 cut(s) 142, 230
BstC8I GCNNGC 2 cut(s) 33, 154
BstDEI CTNAG 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstV1I GCAGC 1 cut(s) 182
BstV2I GAAGAC 1 cut(s) 218
BsuRI GGCC 1 cut(s) 94
Cac8I GCNNGC 2 cut(s) 33, 154
CviJI RGCY 8 cut(s) 24, 35, 80, 94, 152, 173, 216, 253
CviKI_1 RGCY 8 cut(s) 24, 35, 80, 94, 152, 173, 216, 253
DdeI CTNAG 1 cut(s) 66
Eco130I CCWWGG 2 cut(s) 142, 230
EcoT14I CCWWGG 2 cut(s) 142, 230
ErhI CCWWGG 2 cut(s) 142, 230
FaiI YATR 1 cut(s) 243
Fnu4HI GCNGC 1 cut(s) 171
Fsp4HI GCNGC 1 cut(s) 171
FspBI CTAG 3 cut(s) 32, 50, 90
GluI GCNGC 1 cut(s) 171
GsuI CTGGAG 1 cut(s) 195
HaeIII GGCC 1 cut(s) 94
HphI GGTGA 1 cut(s) 191
Hpy188I TCNGA 1 cut(s) 67
HpyCH4V TGCA 3 cut(s) 170, 186, 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 66
LpnPI CCDG 3 cut(s) 31, 159, 186
Lsp1109I GCAGC 1 cut(s) 182
LweI GCATC 2 cut(s) 76, 157
MaeI CTAG 3 cut(s) 32, 50, 90
MboII GAAGA 2 cut(s) 38, 218
MluCI AATT 3 cut(s) 13, 244, 256
MmeI TCCRAC 1 cut(s) 176
MnlI CCTC 3 cut(s) 113, 170, 227
MseI TTAA 1 cut(s) 259
MspA1I CMGCKG 1 cut(s) 173
Mva1269I GAATGC 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 86
NheI GCTAGC 1 cut(s) 31
NlaIV GGNNCC 1 cut(s) 139
PctI GAATGC 1 cut(s) 188
PkrI GCNGC 1 cut(s) 172
PspN4I GGNNCC 1 cut(s) 139
PvuII CAGCTG 1 cut(s) 173
SaqAI TTAA 1 cut(s) 259
SatI GCNGC 1 cut(s) 171
SetI ASST 8 cut(s) 26, 37, 82, 132, 154, 175, 181, 255
SfaNI GCATC 2 cut(s) 76, 157
Sse9I AATT 3 cut(s) 13, 244, 256
SspMI CTAG 3 cut(s) 32, 50, 90
StyI CCWWGG 2 cut(s) 142, 230
TasI AATT 3 cut(s) 13, 244, 256
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
TseI GCWGC 1 cut(s) 170
XspI CTAG 3 cut(s) 32, 50, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.