Rh3BG135800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
11504395 .. 11504748
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG135800.1

Sequence Viewer

Length: 261 bp
ATGGGTGTCTCCAATTCCAGTAGCTCTTTGCTAGCTTTGGTGATTCTTCTAGTTGCTTGTGCATCAGAGAAGTCTTTAGCTGTTGAAGCTAGGCCACTTTCCCTCTTTTCACAACAAGGATATTCAAAGGTATTCGGAACCCTTGGGATAGCTTGTGAGTGTTGTGATGGAGTTGGAGGTGAATGCAAAAGTAGGTGGACTGGTTCTTGCAGTAGCCTCAAATGTCTTCCTTGGAAGCAACATAATTTGAAACTGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.07

Weight (kDa)

8.54

Isoelectric Point (pI)

64.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017326)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g12730
malus_domestica MD04G1138900.v1.1 MD12G1154700.v1.1
prunus_persica Prupe.6G264500_v2.0.a1
pyrus_communis pycom04g12690 pycom12g14690
rosa_chinensis RchiOBHm_Chr3g0464651
rosa_roxburghii Rroxscaffold_6G00415490
rosa_rugosa Rorug03G0073500
rosa_samantha Rh3BG135800 Rh3CG138400 Rh3DG137400
rosa_wichuraiana Rw3G011120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 86, 126, 250
AluBI AGCT 5 cut(s) 24, 35, 80, 89, 152
AluI AGCT 5 cut(s) 24, 35, 80, 89, 152
Alw26I GTCTC 1 cut(s) 13
AoxI GGCC 1 cut(s) 92
AsuHPI GGTGA 2 cut(s) 52, 191
AsuNHI GCTAGC 1 cut(s) 31
BbsI GAAGAC 1 cut(s) 218
BccI CCATC 1 cut(s) 161
BcoDI GTCTC 1 cut(s) 13
BfaI CTAG 3 cut(s) 32, 50, 90
BmiI GGNNCC 1 cut(s) 139
BmsI GCATC 1 cut(s) 71
BmtI GCTAGC 1 cut(s) 35
BpiI GAAGAC 1 cut(s) 218
BsaJI CCNNGG 2 cut(s) 142, 230
Bse1I ACTGG 2 cut(s) 18, 205
BseDI CCNNGG 2 cut(s) 142, 230
BseNI ACTGG 2 cut(s) 18, 205
BshFI GGCC 1 cut(s) 94
BsmAI GTCTC 1 cut(s) 13
BsmI GAATGC 1 cut(s) 188
BsnI GGCC 1 cut(s) 94
BspANI GGCC 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 139
BspOI GCTAGC 1 cut(s) 35
BsrI ACTGG 2 cut(s) 18, 205
BssECI CCNNGG 2 cut(s) 142, 230
BssT1I CCWWGG 2 cut(s) 142, 230
BstC8I GCNNGC 1 cut(s) 33
BstMAI GTCTC 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstV2I GAAGAC 1 cut(s) 218
BsuRI GGCC 1 cut(s) 94
Cac8I GCNNGC 1 cut(s) 33
CviJI RGCY 7 cut(s) 24, 35, 80, 89, 94, 152, 216
CviKI_1 RGCY 7 cut(s) 24, 35, 80, 89, 94, 152, 216
Eco130I CCWWGG 2 cut(s) 142, 230
EcoT14I CCWWGG 2 cut(s) 142, 230
ErhI CCWWGG 2 cut(s) 142, 230
FaiI YATR 1 cut(s) 243
FspBI CTAG 3 cut(s) 32, 50, 90
HaeIII GGCC 1 cut(s) 94
HinfI GANTC 1 cut(s) 43
HphI GGTGA 2 cut(s) 52, 191
Hpy166II GTNNAC 1 cut(s) 198
Hpy188I TCNGA 2 cut(s) 67, 137
Hpy8I GTNNAC 1 cut(s) 198
HpyCH4V TGCA 3 cut(s) 62, 186, 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
LpnPI CCDG 2 cut(s) 31, 186
LweI GCATC 1 cut(s) 71
MaeI CTAG 3 cut(s) 32, 50, 90
MboII GAAGA 2 cut(s) 38, 218
MluCI AATT 3 cut(s) 13, 244, 256
MmeI TCCRAC 1 cut(s) 154
MnlI CCTC 3 cut(s) 113, 170, 227
MseI TTAA 1 cut(s) 259
Mva1269I GAATGC 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 86
NheI GCTAGC 1 cut(s) 31
NlaIV GGNNCC 1 cut(s) 139
PctI GAATGC 1 cut(s) 188
PfeI GAWTC 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 139
SaqAI TTAA 1 cut(s) 259
SetI ASST 8 cut(s) 26, 37, 82, 91, 132, 154, 181, 197
SfaNI GCATC 1 cut(s) 71
Sse9I AATT 3 cut(s) 13, 244, 256
SspMI CTAG 3 cut(s) 32, 50, 90
StyI CCWWGG 2 cut(s) 142, 230
TasI AATT 3 cut(s) 13, 244, 256
TfiI GAWTC 1 cut(s) 43
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
XspI CTAG 3 cut(s) 32, 50, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.