FvH4_7g04901

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Forward (+)
5324767 .. 5325130
364 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g04901.t1

Sequence Viewer

Length: 243 bp
ATGGTCCTTGGAGGAGTTACATATCTATTTGGACCGAGGCAGGGACCTGGTGCGCTTAGCTGGAGAGGATCAGAGGTGATTGATGTCGTTTCAGCGAAGAATGAGGCAACAGTTGGGCAGGTTGGAGGTCCTGCAGTGTTGCAAGTCGATAACTTGGTGATTTGGAGTTTACGGGGAGACTATGGCGAAATTCCGGCAAGTCGCCGAAATCTGACAAGTATTTCTGGCAAGTTTTCGGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.4

Weight (kDa)

8.19

Isoelectric Point (pI)

28.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 109
AclWI GGATC 1 cut(s) 76
AcsI RAATTY 1 cut(s) 189
AfiI CCNNNNNNNGG 1 cut(s) 41
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 1 cut(s) 60
AluI AGCT 1 cut(s) 60
Alw26I GTCTC 1 cut(s) 171
AlwI GGATC 1 cut(s) 76
ApoI RAATTY 1 cut(s) 189
AspLEI GCGC 1 cut(s) 55
AspS9I GGNCC 4 cut(s) 4, 32, 44, 128
AsuHPI GGTGA 2 cut(s) 88, 169
AvaII GGWCC 4 cut(s) 4, 32, 44, 128
BciT130I CCWGG 1 cut(s) 48
BcoDI GTCTC 1 cut(s) 171
BfmI CTRYAG 1 cut(s) 132
BfuAI ACCTGC 1 cut(s) 109
BlpI GCTNAGC 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 48
Bme18I GGWCC 4 cut(s) 4, 32, 44, 128
BmgT120I GGNCC 4 cut(s) 4, 32, 44, 128
BmiI GGNNCC 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 48
BpmI CTGGAG 1 cut(s) 82
Bpu1102I GCTNAGC 1 cut(s) 56
BsaJI CCNNGG 2 cut(s) 7, 35
Bsc4I CCNNNNNNNGG 1 cut(s) 41
BseBI CCWGG 1 cut(s) 48
BseDI CCNNGG 2 cut(s) 7, 35
BseLI CCNNNNNNNGG 1 cut(s) 41
BseRI GAGGAG 1 cut(s) 27
BsiSI CCGG 1 cut(s) 194
BslFI GGGAC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 41
BsmAI GTCTC 1 cut(s) 171
BsmFI GGGAC 1 cut(s) 57
Bsp143I GATC 1 cut(s) 68
Bsp1720I GCTNAGC 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 45
BspMAI CTGCAG 1 cut(s) 136
BspMI ACCTGC 1 cut(s) 109
BspPI GGATC 1 cut(s) 76
BssECI CCNNGG 2 cut(s) 7, 35
BssMI GATC 1 cut(s) 68
BssT1I CCWWGG 1 cut(s) 7
Bst2UI CCWGG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 56
BstHHI GCGC 1 cut(s) 55
BstKTI GATC 1 cut(s) 71
BstMAI GTCTC 1 cut(s) 171
BstMBI GATC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
BstSFI CTRYAG 1 cut(s) 132
BtsI GCAGTG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 141
BveI ACCTGC 1 cut(s) 109
CfoI GCGC 1 cut(s) 55
Cfr13I GGNCC 4 cut(s) 4, 32, 44, 128
CsiI ACCWGGT 1 cut(s) 46
CviJI RGCY 1 cut(s) 60
CviKI_1 RGCY 1 cut(s) 60
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 70
DpnII GATC 1 cut(s) 68
Eco130I CCWWGG 1 cut(s) 7
Eco47I GGWCC 4 cut(s) 4, 32, 44, 128
EcoO109I RGGNCCY 2 cut(s) 44, 128
EcoRII CCWGG 1 cut(s) 46
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaiI YATR 2 cut(s) 22, 183
FaqI GGGAC 1 cut(s) 57
GlaI GCGC 1 cut(s) 54
GsuI CTGGAG 1 cut(s) 82
HapII CCGG 1 cut(s) 194
HhaI GCGC 1 cut(s) 55
Hin6I GCGC 1 cut(s) 53
HinP1I GCGC 1 cut(s) 53
HpaII CCGG 1 cut(s) 194
HphI GGTGA 2 cut(s) 88, 169
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 2 cut(s) 73, 213
Hpy8I GTNNAC 1 cut(s) 170
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4V TGCA 2 cut(s) 134, 142
HpyF3I CTNAG 1 cut(s) 56
HspAI GCGC 1 cut(s) 53
Kzo9I GATC 1 cut(s) 68
LpnPI CCDG 8 cut(s) 26, 33, 46, 60, 104, 144, 207, 210
MabI ACCWGGT 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 16
MalI GATC 1 cut(s) 70
MboI GATC 1 cut(s) 68
MboII GAAGA 1 cut(s) 109
MluCI AATT 1 cut(s) 189
MmeI TCCRAC 1 cut(s) 103
MnlI CCTC 6 cut(s) 5, 30, 59, 67, 97, 119
MspI CCGG 1 cut(s) 194
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
NdeII GATC 1 cut(s) 68
NlaIV GGNNCC 1 cut(s) 45
PpuMI RGGWCCY 2 cut(s) 44, 128
Psp5II RGGWCCY 2 cut(s) 44, 128
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PspN4I GGNNCC 1 cut(s) 45
PspPI GGNCC 4 cut(s) 4, 32, 44, 128
PspPPI RGGWCCY 2 cut(s) 44, 128
PstI CTGCAG 1 cut(s) 136
Sau3AI GATC 1 cut(s) 68
Sau96I GGNCC 4 cut(s) 4, 32, 44, 128
ScrFI CCNGG 1 cut(s) 48
SetI ASST 5 cut(s) 49, 62, 78, 123, 130
SexAI ACCWGGT 1 cut(s) 46
SfcI CTRYAG 1 cut(s) 132
SinI GGWCC 4 cut(s) 4, 32, 44, 128
Sse9I AATT 1 cut(s) 189
StyD4I CCNGG 1 cut(s) 46
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 1 cut(s) 112
TaqI TCGA 1 cut(s) 147
TaqII GACCGA 1 cut(s) 49
TasI AATT 1 cut(s) 189
TscAI CASTG 1 cut(s) 141
TspRI CASTG 1 cut(s) 141
VpaK11BI GGWCC 4 cut(s) 4, 32, 44, 128
XapI RAATTY 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.