FvH4_7g23600

Protease inhibitor seed storage lipid transfer family protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Reverse (-)
18370361 .. 18370836
476 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g23600.t1

Sequence Viewer

Length: 357 bp
ATGGAAGCTGCAATGAAGAACATTTGCCTTGTTGCTTTCGTTGTCCTTCTGGGTGTTGCTCAGTTCAATGCGGCTTATGGGGCTGGTGAATGTGGAAAATCTAGCCCTGACAGTGAGGCTTGGAAGCTGATTCCGTGTGCATCAGCAGCACAAAGTGAGAATGCTGCAGTTTCTGCTAAGTGCTGCACTCAGGTAAAGAGGATAGGTCAGAACCCGAGCTGCCTCTGTGCCGTGATGCTTTCTAATACTGCAAAGAGTTCAGGAGTGAAACCAGAAATTGCTATTACTATTCCAAAACGTTGTAACATTCCTGATCGTCCTATTGGCTACAAGTGCGGAGCCTATACATTACCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

12.28

Weight (kDa)

8.77

Isoelectric Point (pI)

46.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 29 - 108 2.3e-11 Probable lipid transfer
Tryp_alpha_amyl PF00234 42 - 112 7.5e-10 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016544)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 71, 336
AclI AACGTT 1 cut(s) 298
AdeI CACNNNGTG 1 cut(s) 155
AgsI TTSAA 1 cut(s) 67
AluBI AGCT 3 cut(s) 8, 127, 219
AluI AGCT 3 cut(s) 8, 127, 219
AlwNI CAGNNNCTG 1 cut(s) 173
Ama87I CYCGRG 1 cut(s) 214
ApeKI GCWGC 5 cut(s) 8, 146, 164, 183, 219
AsuHPI GGTGA 1 cut(s) 98
AvaI CYCGRG 1 cut(s) 214
BbvI GCAGC 4 cut(s) 151, 158, 170, 206
BceAI ACGGC 1 cut(s) 215
BfaI CTAG 1 cut(s) 102
BfmI CTRYAG 1 cut(s) 165
BisI GCNGC 6 cut(s) 9, 72, 147, 165, 184, 220
BlsI GCNGC 6 cut(s) 10, 73, 148, 166, 185, 221
BmeT110I CYCGRG 1 cut(s) 214
BmiI GGNNCC 1 cut(s) 340
BmsI GCATC 2 cut(s) 149, 225
Bse3DI GCAATG 1 cut(s) 18
BseMI GCAATG 1 cut(s) 18
BseMII CTCAG 2 cut(s) 74, 203
BseXI GCAGC 4 cut(s) 151, 158, 170, 206
BsgI GTGCAG 1 cut(s) 169
BsiHKCI CYCGRG 1 cut(s) 214
BsmI GAATGC 1 cut(s) 166
BsoBI CYCGRG 1 cut(s) 214
Bsp143I GATC 1 cut(s) 313
BspACI CCGC 2 cut(s) 71, 336
BspCNI CTCAG 2 cut(s) 73, 202
BspLI GGNNCC 1 cut(s) 340
BspMAI CTGCAG 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 18
BssMI GATC 1 cut(s) 313
Bst4CI ACNGT 1 cut(s) 113
BstAPI GCANNNNNTGC 1 cut(s) 173
BstDEI CTNAG 3 cut(s) 60, 177, 189
BstKTI GATC 1 cut(s) 316
BstMBI GATC 1 cut(s) 313
BstMWI GCNNNNNNNGC 4 cut(s) 80, 146, 173, 333
BstSFI CTRYAG 1 cut(s) 165
BstV1I GCAGC 4 cut(s) 151, 158, 170, 206
BtsIMutI CAGTG 1 cut(s) 118
CaiI CAGNNNCTG 1 cut(s) 173
CviJI RGCY 9 cut(s) 8, 74, 83, 105, 119, 127, 219, 327, 341
CviKI_1 RGCY 9 cut(s) 8, 74, 83, 105, 119, 127, 219, 327, 341
DdeI CTNAG 3 cut(s) 60, 177, 189
DpnI GATC 1 cut(s) 315
DpnII GATC 1 cut(s) 313
DraIII CACNNNGTG 1 cut(s) 155
Eco88I CYCGRG 1 cut(s) 214
FaiI YATR 2 cut(s) 78, 345
Fnu4HI GCNGC 6 cut(s) 9, 72, 147, 165, 184, 220
Fsp4HI GCNGC 6 cut(s) 9, 72, 147, 165, 184, 220
FspBI CTAG 1 cut(s) 102
GluI GCNGC 6 cut(s) 9, 72, 147, 165, 184, 220
HinfI GANTC 1 cut(s) 130
HphI GGTGA 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 210
Hpy188III TCNNGA 2 cut(s) 261, 311
HpyAV CCTTC 1 cut(s) 56
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4IV ACGT 1 cut(s) 298
HpyCH4V TGCA 5 cut(s) 11, 140, 167, 186, 251
HpyF10VI GCNNNNNNNGC 4 cut(s) 80, 146, 173, 333
HpyF3I CTNAG 3 cut(s) 60, 177, 189
HpySE526I ACGT 1 cut(s) 298
Kzo9I GATC 1 cut(s) 313
LmnI GCTCC 1 cut(s) 338
LpnPI CCDG 7 cut(s) 35, 69, 120, 176, 246, 285, 324
Lsp1109I GCAGC 4 cut(s) 151, 158, 170, 206
LweI GCATC 2 cut(s) 149, 225
MaeI CTAG 1 cut(s) 102
MaeII ACGT 1 cut(s) 298
MaeIII GTNAC 1 cut(s) 302
MalI GATC 1 cut(s) 315
MboI GATC 1 cut(s) 313
MboII GAAGA 1 cut(s) 28
MluCI AATT 1 cut(s) 276
MnlI CCTC 3 cut(s) 109, 192, 233
Mva1269I GAATGC 1 cut(s) 166
MwoI GCNNNNNNNGC 4 cut(s) 80, 146, 173, 333
NdeII GATC 1 cut(s) 313
NlaIV GGNNCC 1 cut(s) 340
PctI GAATGC 1 cut(s) 166
PfeI GAWTC 1 cut(s) 130
PkrI GCNGC 6 cut(s) 10, 73, 148, 166, 185, 221
Psp1406I AACGTT 1 cut(s) 298
PspN4I GGNNCC 1 cut(s) 340
PstI CTGCAG 1 cut(s) 169
PstNI CAGNNNCTG 1 cut(s) 173
SatI GCNGC 6 cut(s) 9, 72, 147, 165, 184, 220
Sau3AI GATC 1 cut(s) 313
SetI ASST 6 cut(s) 10, 129, 195, 208, 221, 301
SfaNI GCATC 2 cut(s) 149, 225
SfcI CTRYAG 1 cut(s) 165
Sse9I AATT 1 cut(s) 276
SsiI CCGC 2 cut(s) 71, 336
SspMI CTAG 1 cut(s) 102
TaaI ACNGT 1 cut(s) 113
TaiI ACGT 1 cut(s) 301
TasI AATT 1 cut(s) 276
TauI GCSGC 1 cut(s) 74
TfiI GAWTC 1 cut(s) 130
TscAI CASTG 1 cut(s) 118
TseI GCWGC 5 cut(s) 8, 146, 164, 183, 219
TspDTI ATGAA 1 cut(s) 29
TspGWI ACGGA 1 cut(s) 123
TspRI CASTG 1 cut(s) 118
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.