Rh1DG347300

Protease inhibitor seed storage lipid transfer family protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
57131131 .. 57131591
461 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG347300.1

Sequence Viewer

Length: 357 bp
ATGGAAGCTGCAATGAAGAACATTTGCCTCGTAGCTTTTCTTGTGATTCTGGGTGTCGCTCAGTTCGATGGGGCTTATGGGGCTGGTGAATGTGGAAAATCCAACCCAGACACTGAGGCTTGGAAGCTGGCTCCGTGTGCAGCAGCAGCACAAGATGCGAATGCTGCAGTTTCTTCTAAGTGCTGCAGTCAGGTAAAGAGGATAGGTCAGAACCCAAGCTGCCTCTGCGCCGTGATGCTTTCTAATACTGCCAAGACTTCAGGAGTGAAACCAGAAGTTGCTCTTACTATTCCAAAACGTTGTAACATTTCTGATCGTCCTGTTGGCTACAAGTGTGGAGCTTATACATTACCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

12.22

Weight (kDa)

8.6

Isoelectric Point (pI)

37.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 31 - 108 4.2e-11 Probable lipid transfer
Tryp_alpha_amyl PF00234 42 - 112 1e-10 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016544)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 298
AcuI CTGAAG 1 cut(s) 243
AluBI AGCT 5 cut(s) 8, 35, 127, 219, 341
AluI AGCT 5 cut(s) 8, 35, 127, 219, 341
AlwNI CAGNNNCTG 1 cut(s) 113
ApeKI GCWGC 7 cut(s) 8, 140, 143, 146, 164, 183, 219
AspLEI GCGC 1 cut(s) 230
AsuHPI GGTGA 1 cut(s) 98
BbvI GCAGC 6 cut(s) 151, 152, 155, 158, 170, 206
BccI CCATC 1 cut(s) 62
BceAI ACGGC 1 cut(s) 215
BfmI CTRYAG 2 cut(s) 165, 184
BisI GCNGC 7 cut(s) 9, 141, 144, 147, 165, 184, 220
BlsI GCNGC 7 cut(s) 10, 142, 145, 148, 166, 185, 221
BmiI GGNNCC 1 cut(s) 132
BmsI GCATC 2 cut(s) 145, 225
Bse3DI GCAATG 1 cut(s) 18
BseMI GCAATG 1 cut(s) 18
BseMII CTCAG 2 cut(s) 74, 105
BseXI GCAGC 6 cut(s) 151, 152, 155, 158, 170, 206
BsgI GTGCAG 1 cut(s) 159
BsmI GAATGC 1 cut(s) 166
Bsp143I GATC 1 cut(s) 313
BspCNI CTCAG 2 cut(s) 73, 106
BspLI GGNNCC 1 cut(s) 132
BspMAI CTGCAG 2 cut(s) 169, 188
BsrDI GCAATG 1 cut(s) 18
BssMI GATC 1 cut(s) 313
BstAPI GCANNNNNTGC 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 129
BstDEI CTNAG 3 cut(s) 60, 114, 177
BstHHI GCGC 1 cut(s) 230
BstKTI GATC 1 cut(s) 316
BstMBI GATC 1 cut(s) 313
BstMWI GCNNNNNNNGC 6 cut(s) 80, 137, 146, 155, 164, 225
BstSFI CTRYAG 2 cut(s) 165, 184
BstV1I GCAGC 6 cut(s) 151, 152, 155, 158, 170, 206
BtsIMutI CAGTG 1 cut(s) 111
Cac8I GCNNGC 1 cut(s) 129
CaiI CAGNNNCTG 1 cut(s) 113
CfoI GCGC 1 cut(s) 230
DdeI CTNAG 3 cut(s) 60, 114, 177
DpnI GATC 1 cut(s) 315
DpnII GATC 1 cut(s) 313
Eco57I CTGAAG 1 cut(s) 243
FaiI YATR 2 cut(s) 78, 345
FalI AAGNNNNNCTT 2 cut(s) 267, 299
Fnu4HI GCNGC 7 cut(s) 9, 141, 144, 147, 165, 184, 220
Fsp4HI GCNGC 7 cut(s) 9, 141, 144, 147, 165, 184, 220
GlaI GCGC 1 cut(s) 229
GluI GCNGC 7 cut(s) 9, 141, 144, 147, 165, 184, 220
HhaI GCGC 1 cut(s) 230
Hin6I GCGC 1 cut(s) 228
HinP1I GCGC 1 cut(s) 228
HinfI GANTC 1 cut(s) 46
HphI GGTGA 1 cut(s) 98
Hpy188I TCNGA 2 cut(s) 210, 313
Hpy188III TCNNGA 1 cut(s) 261
HpyCH4IV ACGT 1 cut(s) 298
HpyCH4V TGCA 4 cut(s) 11, 140, 167, 186
HpyF10VI GCNNNNNNNGC 6 cut(s) 80, 137, 146, 155, 164, 225
HpyF3I CTNAG 3 cut(s) 60, 114, 177
HpySE526I ACGT 1 cut(s) 298
HspAI GCGC 1 cut(s) 228
Kzo9I GATC 1 cut(s) 313
LmnI GCTCC 2 cut(s) 136, 338
LpnPI CCDG 8 cut(s) 35, 69, 113, 120, 176, 246, 285, 333
Lsp1109I GCAGC 6 cut(s) 151, 152, 155, 158, 170, 206
LweI GCATC 2 cut(s) 145, 225
MaeII ACGT 1 cut(s) 298
MaeIII GTNAC 1 cut(s) 302
MalI GATC 1 cut(s) 315
MboI GATC 1 cut(s) 313
MboII GAAGA 2 cut(s) 28, 165
MmeI TCCRAC 1 cut(s) 126
MnlI CCTC 4 cut(s) 38, 109, 192, 233
Mva1269I GAATGC 1 cut(s) 166
MwoI GCNNNNNNNGC 6 cut(s) 80, 137, 146, 155, 164, 225
NdeII GATC 1 cut(s) 313
NlaIV GGNNCC 1 cut(s) 132
PcsI WCGNNNNNNNCGW 1 cut(s) 63
PctI GAATGC 1 cut(s) 166
PfeI GAWTC 1 cut(s) 46
PkrI GCNGC 7 cut(s) 10, 142, 145, 148, 166, 185, 221
Psp1406I AACGTT 1 cut(s) 298
PspN4I GGNNCC 1 cut(s) 132
PstI CTGCAG 2 cut(s) 169, 188
PstNI CAGNNNCTG 1 cut(s) 113
SatI GCNGC 7 cut(s) 9, 141, 144, 147, 165, 184, 220
Sau3AI GATC 1 cut(s) 313
SetI ASST 8 cut(s) 10, 37, 129, 195, 208, 221, 301, 343
SfaNI GCATC 2 cut(s) 145, 225
SfcI CTRYAG 2 cut(s) 165, 184
TaiI ACGT 1 cut(s) 301
TaqI TCGA 1 cut(s) 66
TfiI GAWTC 1 cut(s) 46
TscAI CASTG 1 cut(s) 118
TseI GCWGC 7 cut(s) 8, 140, 143, 146, 164, 183, 219
TspDTI ATGAA 1 cut(s) 29
TspGWI ACGGA 1 cut(s) 123
TspRI CASTG 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.