Prupe.2G242800_v2.0.a1

Protease inhibitor seed storage lipid transfer family protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
26158162 .. 26158626
465 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G242800.1

Sequence Viewer

Length: 357 bp
ATGGAATCTACAATGAAGTTTATGTGCCTTGTAGCGTTTGTTGTGATTCTGGGCATCAATCAATTCGATGGGGCTTACGGGGCTGGCGAGTGTGGAAAATCTAGCCCCGACAGAGAGGCCTGGAAGCTGGCTCCCTGTGCAGCAGCAGCACAAGATGAAAATGCTGCAGTTTCTGATAAGTGCTGCAGTCAGGTAAAAAGGATAGGCCAGAACCCAAGCTGCCTCTGTGCTGTGATGCTTTCTAATACTGCTAAGAGTGCAGGAATCAAACCAGAAATAGCTCTTACCATTCCGAAACGATGTAACATTGTGGATCGTCCTGTGGGTTTCAAGTGTGGAGCATATACATTACCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

12.46

Weight (kDa)

8.39

Isoelectric Point (pI)

34.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016544)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 321
AgsI TTSAA 1 cut(s) 331
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 3 cut(s) 127, 219, 281
AluI AGCT 3 cut(s) 127, 219, 281
AlwI GGATC 1 cut(s) 321
AlwNI CAGNNNCTG 1 cut(s) 173
AoxI GGCC 2 cut(s) 117, 205
ApeKI GCWGC 6 cut(s) 140, 143, 146, 164, 183, 219
BbvI GCAGC 6 cut(s) 151, 152, 155, 158, 170, 206
BccI CCATC 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 121
BfaI CTAG 1 cut(s) 102
BfmI CTRYAG 2 cut(s) 165, 184
BisI GCNGC 6 cut(s) 141, 144, 147, 165, 184, 220
BlsI GCNGC 6 cut(s) 142, 145, 148, 166, 185, 221
Bme1390I CCNGG 1 cut(s) 121
BmiI GGNNCC 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 121
BmsI GCATC 2 cut(s) 63, 225
BseBI CCWGG 1 cut(s) 121
BseXI GCAGC 6 cut(s) 151, 152, 155, 158, 170, 206
BsgI GTGCAG 2 cut(s) 159, 279
BshFI GGCC 2 cut(s) 119, 207
BsnI GGCC 2 cut(s) 119, 207
Bsp143I GATC 1 cut(s) 313
BspANI GGCC 2 cut(s) 119, 207
BspLI GGNNCC 1 cut(s) 132
BspMAI CTGCAG 2 cut(s) 169, 188
BspPI GGATC 1 cut(s) 321
BssMI GATC 1 cut(s) 313
Bst2UI CCWGG 1 cut(s) 121
BstC8I GCNNGC 2 cut(s) 85, 129
BstDEI CTNAG 1 cut(s) 252
BstKTI GATC 1 cut(s) 316
BstMBI GATC 1 cut(s) 313
BstMWI GCNNNNNNNGC 4 cut(s) 80, 137, 146, 257
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
BstSFI CTRYAG 2 cut(s) 165, 184
BstV1I GCAGC 6 cut(s) 151, 152, 155, 158, 170, 206
BsuRI GGCC 2 cut(s) 119, 207
Cac8I GCNNGC 2 cut(s) 85, 129
CaiI CAGNNNCTG 1 cut(s) 173
CviJI RGCY 9 cut(s) 74, 83, 105, 119, 127, 131, 207, 219, 281
CviKI_1 RGCY 9 cut(s) 74, 83, 105, 119, 127, 131, 207, 219, 281
DdeI CTNAG 1 cut(s) 252
DpnI GATC 1 cut(s) 315
DpnII GATC 1 cut(s) 313
Eco147I AGGCCT 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 119
FaiI YATR 3 cut(s) 23, 343, 345
Fnu4HI GCNGC 6 cut(s) 141, 144, 147, 165, 184, 220
Fsp4HI GCNGC 6 cut(s) 141, 144, 147, 165, 184, 220
FspBI CTAG 1 cut(s) 102
GluI GCNGC 6 cut(s) 141, 144, 147, 165, 184, 220
HaeIII GGCC 2 cut(s) 119, 207
HinfI GANTC 3 cut(s) 5, 46, 264
Hpy188I TCNGA 2 cut(s) 175, 294
HpyCH4V TGCA 4 cut(s) 140, 167, 186, 260
HpyF10VI GCNNNNNNNGC 4 cut(s) 80, 137, 146, 257
HpyF3I CTNAG 1 cut(s) 252
Kzo9I GATC 1 cut(s) 313
LmnI GCTCC 2 cut(s) 136, 338
Lsp1109I GCAGC 6 cut(s) 151, 152, 155, 158, 170, 206
LweI GCATC 2 cut(s) 63, 225
MaeI CTAG 1 cut(s) 102
MaeIII GTNAC 1 cut(s) 302
MalI GATC 1 cut(s) 315
MboI GATC 1 cut(s) 313
MluCI AATT 1 cut(s) 62
MnlI CCTC 2 cut(s) 109, 233
MspR9I CCNGG 1 cut(s) 121
MvaI CCWGG 1 cut(s) 121
MwoI GCNNNNNNNGC 4 cut(s) 80, 137, 146, 257
NdeII GATC 1 cut(s) 313
NlaIV GGNNCC 1 cut(s) 132
PceI AGGCCT 1 cut(s) 119
PcsI WCGNNNNNNNCGW 1 cut(s) 84
PfeI GAWTC 3 cut(s) 5, 46, 264
PkrI GCNGC 6 cut(s) 142, 145, 148, 166, 185, 221
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
PspN4I GGNNCC 1 cut(s) 132
PstI CTGCAG 2 cut(s) 169, 188
PstNI CAGNNNCTG 1 cut(s) 173
SatI GCNGC 6 cut(s) 141, 144, 147, 165, 184, 220
Sau3AI GATC 1 cut(s) 313
ScrFI CCNGG 1 cut(s) 121
SetI ASST 4 cut(s) 129, 195, 221, 283
SfaNI GCATC 2 cut(s) 63, 225
SfcI CTRYAG 2 cut(s) 165, 184
Sse9I AATT 1 cut(s) 62
SseBI AGGCCT 1 cut(s) 119
SspMI CTAG 1 cut(s) 102
StuI AGGCCT 1 cut(s) 119
StyD4I CCNGG 1 cut(s) 119
TaqI TCGA 1 cut(s) 66
TasI AATT 1 cut(s) 62
TfiI GAWTC 3 cut(s) 5, 46, 264
TseI GCWGC 6 cut(s) 140, 143, 146, 164, 183, 219
TspDTI ATGAA 2 cut(s) 29, 171
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.