Rh1AG352300

Protease inhibitor seed storage lipid transfer family protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
58828835 .. 58830018
1184 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG352300.1

Sequence Viewer

Length: 345 bp
ATGAAGAACATTTGCCTTGTAGCTTTTCTTGTGATTCTGGGTGTCGCTCAGTTCGATGGGGCTTATGGGGCTGGTGAATGTGGAAAATCCAACCCAGACACTGTGGCTTGGAAGCTGGCTCCGTGTGCAGCAGCAGCACAAGATGTGAATGCTGCAGTTTCTTCTAAGTGCTGCAGTCAGGTAAAGAGTATAGGTCAGAACCCAAGCTGCCTCTGTGCCGTGATGCTTTCTAGTACTGCTAAGACTTCAGGAGTGAAACCAGAAGTTGCTGTTACTATTCCTAAACGTTGTAACATTCCTGATCGTCCTGTTGGCTACAAGTGTGGAGGTTATACATTACCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

11.7

Weight (kDa)

8.77

Isoelectric Point (pI)

35.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 27 - 104 1.2e-10 Probable lipid transfer
Tryp_alpha_amyl PF00234 37 - 108 4.7e-10 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016544)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 286
AcuI CTGAAG 1 cut(s) 231
AfaI GTAC 1 cut(s) 235
AluBI AGCT 3 cut(s) 23, 115, 207
AluI AGCT 3 cut(s) 23, 115, 207
AlwNI CAGNNNCTG 1 cut(s) 101
ApeKI GCWGC 6 cut(s) 128, 131, 134, 152, 171, 207
AsuHPI GGTGA 1 cut(s) 86
BbvI GCAGC 6 cut(s) 139, 140, 143, 146, 158, 194
BccI CCATC 1 cut(s) 50
BceAI ACGGC 1 cut(s) 203
BfaI CTAG 1 cut(s) 231
BfmI CTRYAG 2 cut(s) 153, 172
BisI GCNGC 6 cut(s) 129, 132, 135, 153, 172, 208
BlsI GCNGC 6 cut(s) 130, 133, 136, 154, 173, 209
BmcAI AGTACT 1 cut(s) 235
BmiI GGNNCC 1 cut(s) 120
BmsI GCATC 1 cut(s) 213
BseMII CTCAG 1 cut(s) 62
BseXI GCAGC 6 cut(s) 139, 140, 143, 146, 158, 194
BsgI GTGCAG 1 cut(s) 147
BsmI GAATGC 1 cut(s) 154
Bsp143I GATC 1 cut(s) 301
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 120
BspMAI CTGCAG 2 cut(s) 157, 176
BssMI GATC 1 cut(s) 301
Bst4CI ACNGT 1 cut(s) 103
BstC8I GCNNGC 1 cut(s) 117
BstDEI CTNAG 3 cut(s) 48, 165, 240
BstKTI GATC 1 cut(s) 304
BstMBI GATC 1 cut(s) 301
BstMWI GCNNNNNNNGC 3 cut(s) 68, 125, 134
BstSFI CTRYAG 2 cut(s) 153, 172
BstV1I GCAGC 6 cut(s) 139, 140, 143, 146, 158, 194
BtsIMutI CAGTG 1 cut(s) 99
Cac8I GCNNGC 1 cut(s) 117
CaiI CAGNNNCTG 1 cut(s) 101
Csp6I GTAC 1 cut(s) 234
CviJI RGCY 8 cut(s) 23, 62, 71, 107, 115, 119, 207, 315
CviKI_1 RGCY 8 cut(s) 23, 62, 71, 107, 115, 119, 207, 315
CviQI GTAC 1 cut(s) 234
DdeI CTNAG 3 cut(s) 48, 165, 240
DpnI GATC 1 cut(s) 303
DpnII GATC 1 cut(s) 301
Eco57I CTGAAG 1 cut(s) 231
FaiI YATR 3 cut(s) 66, 191, 333
Fnu4HI GCNGC 6 cut(s) 129, 132, 135, 153, 172, 208
Fsp4HI GCNGC 6 cut(s) 129, 132, 135, 153, 172, 208
FspBI CTAG 1 cut(s) 231
GluI GCNGC 6 cut(s) 129, 132, 135, 153, 172, 208
HinfI GANTC 1 cut(s) 34
HphI GGTGA 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 198
Hpy188III TCNNGA 2 cut(s) 249, 299
HpyCH4III ACNGT 1 cut(s) 103
HpyCH4IV ACGT 1 cut(s) 286
HpyCH4V TGCA 3 cut(s) 128, 155, 174
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 125, 134
HpyF3I CTNAG 3 cut(s) 48, 165, 240
HpySE526I ACGT 1 cut(s) 286
Kzo9I GATC 1 cut(s) 301
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 9 cut(s) 23, 57, 101, 108, 164, 234, 273, 312, 321
Lsp1109I GCAGC 6 cut(s) 139, 140, 143, 146, 158, 194
LweI GCATC 1 cut(s) 213
MaeI CTAG 1 cut(s) 231
MaeII ACGT 1 cut(s) 286
MaeIII GTNAC 2 cut(s) 271, 290
MalI GATC 1 cut(s) 303
MboI GATC 1 cut(s) 301
MboII GAAGA 2 cut(s) 16, 153
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 2 cut(s) 221, 320
Mva1269I GAATGC 1 cut(s) 154
MwoI GCNNNNNNNGC 3 cut(s) 68, 125, 134
NdeII GATC 1 cut(s) 301
NlaIV GGNNCC 1 cut(s) 120
PcsI WCGNNNNNNNCGW 1 cut(s) 51
PctI GAATGC 1 cut(s) 154
PfeI GAWTC 1 cut(s) 34
PkrI GCNGC 6 cut(s) 130, 133, 136, 154, 173, 209
Psp1406I AACGTT 1 cut(s) 286
PspN4I GGNNCC 1 cut(s) 120
PstI CTGCAG 2 cut(s) 157, 176
PstNI CAGNNNCTG 1 cut(s) 101
RsaI GTAC 1 cut(s) 235
RsaNI GTAC 1 cut(s) 234
SatI GCNGC 6 cut(s) 129, 132, 135, 153, 172, 208
Sau3AI GATC 1 cut(s) 301
ScaI AGTACT 1 cut(s) 235
SetI ASST 7 cut(s) 25, 117, 183, 196, 209, 289, 331
SfaNI GCATC 1 cut(s) 213
SfcI CTRYAG 2 cut(s) 153, 172
SspMI CTAG 1 cut(s) 231
TaaI ACNGT 1 cut(s) 103
TaiI ACGT 1 cut(s) 289
TaqI TCGA 1 cut(s) 54
TatI WGTACW 1 cut(s) 233
TfiI GAWTC 1 cut(s) 34
TscAI CASTG 1 cut(s) 106
TseI GCWGC 6 cut(s) 128, 131, 134, 152, 171, 207
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 111
TspRI CASTG 1 cut(s) 106
XspI CTAG 1 cut(s) 231
ZrmI AGTACT 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.