MD00G1140100.v1.1

chloroplast RF68

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
30561347 .. 30561682
336 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1140100.v1.1.491

Sequence Viewer

Length: 336 bp
ATGTTTCTCCTGTTCGAACCGGGGTTTGAAACCAAACTTCTACTCAGGAGGATAGATGGGGCGATTCAGGTGAGATCCAATATAGATCCAACTTTCTATTCACTCGTGGGATCCAGGCGGTCCGGGAGGGACCACCACGACTCCTCTCTTTCTCGAGAATCCATACATCCCTTATCAGTATATGGACAGCTATCTCTCGAGCAGGCGGTCCGGGAGGGACCACCACGACTCCTCTCTTCTCGAGAATCCATACATCCCTTATCAGTATATGGACAGCTATCTCTCGAGCACAGGTTTAGGTTCGGCCTCAATGGGAAAATAAAATGGAGCACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.68

Weight (kDa)

9.97

Isoelectric Point (pI)

47.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF2647 PF10839 11 - 68 1.1e-23 Protein of unknown function (DUF2647)
DUF2647 PF10839 73 - 97 2e-06 Protein of unknown function (DUF2647)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020370)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 118, 206
AclWI GGATC 4 cut(s) 69, 80, 105, 118
AgsI TTSAA 1 cut(s) 29
AjnI CCWGG 1 cut(s) 113
AjuI GAANNNNNNNTTGG 2 cut(s) 82, 114
AluBI AGCT 2 cut(s) 190, 277
AluI AGCT 2 cut(s) 190, 277
Alw21I GWGCWC 2 cut(s) 291, 332
AlwI GGATC 4 cut(s) 69, 80, 105, 118
Ama87I CYCGRG 4 cut(s) 153, 197, 240, 284
AoxI GGCC 1 cut(s) 304
AspS9I GGNCC 4 cut(s) 120, 130, 208, 218
AsuC2I CCSGG 3 cut(s) 21, 124, 212
AsuHPI GGTGA 1 cut(s) 82
AsuII TTCGAA 1 cut(s) 15
AvaI CYCGRG 4 cut(s) 153, 197, 240, 284
AvaII GGWCC 4 cut(s) 120, 130, 208, 218
BamHI GGATCC 1 cut(s) 110
BauI CACGAG 1 cut(s) 104
Bbv12I GWGCWC 2 cut(s) 291, 332
BccI CCATC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 115
BcnI CCSGG 3 cut(s) 21, 124, 212
Bme1390I CCNGG 4 cut(s) 21, 115, 124, 212
Bme18I GGWCC 4 cut(s) 120, 130, 208, 218
BmeT110I CYCGRG 4 cut(s) 153, 197, 240, 284
BmgT120I GGNCC 4 cut(s) 120, 130, 208, 218
BmiI GGNNCC 3 cut(s) 112, 131, 219
BmrFI CCNGG 4 cut(s) 21, 115, 124, 212
Bpu14I TTCGAA 1 cut(s) 15
BpuMI CCSGG 3 cut(s) 21, 124, 212
BsaJI CCNNGG 1 cut(s) 20
BsaXI ACNNNNNCTCC 4 cut(s) 125, 155, 213, 243
BseBI CCWGG 1 cut(s) 115
BseDI CCNNGG 1 cut(s) 20
BseGI GGATG 2 cut(s) 166, 253
BseMII CTCAG 1 cut(s) 58
BseRI GAGGAG 2 cut(s) 133, 221
BshFI GGCC 1 cut(s) 306
BsiHKAI GWGCWC 2 cut(s) 291, 332
BsiHKCI CYCGRG 4 cut(s) 153, 197, 240, 284
BsiSI CCGG 3 cut(s) 20, 123, 211
BslFI GGGAC 2 cut(s) 143, 231
BsmFI GGGAC 2 cut(s) 143, 231
BsnI GGCC 1 cut(s) 306
BsoBI CYCGRG 4 cut(s) 153, 197, 240, 284
Bsp119I TTCGAA 1 cut(s) 15
Bsp1286I GDGCHC 2 cut(s) 291, 332
Bsp143I GATC 3 cut(s) 74, 85, 110
BspACI CCGC 2 cut(s) 118, 206
BspANI GGCC 1 cut(s) 306
BspCNI CTCAG 1 cut(s) 57
BspLI GGNNCC 3 cut(s) 112, 131, 219
BspPI GGATC 4 cut(s) 69, 80, 105, 118
BspT104I TTCGAA 1 cut(s) 15
BssECI CCNNGG 1 cut(s) 20
BssMI GATC 3 cut(s) 74, 85, 110
BssSI CACGAG 1 cut(s) 104
Bst2BI CACGAG 1 cut(s) 104
Bst2UI CCWGG 1 cut(s) 115
Bst6I CTCTTC 1 cut(s) 241
BstBI TTCGAA 1 cut(s) 15
BstC8I GCNNGC 1 cut(s) 204
BstDEI CTNAG 1 cut(s) 44
BstF5I GGATG 2 cut(s) 166, 253
BstKTI GATC 3 cut(s) 77, 88, 113
BstMBI GATC 3 cut(s) 74, 85, 110
BstNI CCWGG 1 cut(s) 115
BstSCI CCNGG 4 cut(s) 19, 113, 122, 210
BstX2I RGATCY 3 cut(s) 74, 85, 110
BstYI RGATCY 3 cut(s) 74, 85, 110
BsuRI GGCC 1 cut(s) 306
BtsCI GGATG 2 cut(s) 166, 253
Cac8I GCNNGC 1 cut(s) 204
Cfr13I GGNCC 4 cut(s) 120, 130, 208, 218
CpoI CGGWCCG 2 cut(s) 120, 208
CspI CGGWCCG 2 cut(s) 120, 208
CviJI RGCY 3 cut(s) 190, 277, 306
CviKI_1 RGCY 3 cut(s) 190, 277, 306
DdeI CTNAG 1 cut(s) 44
DpnI GATC 3 cut(s) 76, 87, 112
DpnII GATC 3 cut(s) 74, 85, 110
Eam1104I CTCTTC 1 cut(s) 241
EarI CTCTTC 1 cut(s) 241
Eco47I GGWCC 4 cut(s) 120, 130, 208, 218
Eco88I CYCGRG 4 cut(s) 153, 197, 240, 284
EcoRII CCWGG 1 cut(s) 113
FaiI YATR 7 cut(s) 83, 164, 181, 183, 251, 268, 270
FaqI GGGAC 2 cut(s) 143, 231
FokI GGATG 2 cut(s) 153, 240
HaeIII GGCC 1 cut(s) 306
HapII CCGG 3 cut(s) 20, 123, 211
HinfI GANTC 5 cut(s) 64, 140, 158, 228, 245
HpaII CCGG 3 cut(s) 20, 123, 211
HphI GGTGA 1 cut(s) 82
Hpy188III TCNNGA 7 cut(s) 46, 153, 155, 197, 240, 242, 284
HpyF3I CTNAG 1 cut(s) 44
Kzo9I GATC 3 cut(s) 74, 85, 110
LmnI GCTCC 1 cut(s) 327
MalI GATC 3 cut(s) 76, 87, 112
MboI GATC 3 cut(s) 74, 85, 110
MboII GAAGA 1 cut(s) 228
MflI RGATCY 3 cut(s) 74, 85, 110
MhlI GDGCHC 2 cut(s) 291, 332
MlyI GAGTC 2 cut(s) 134, 222
MmeI TCCRAC 1 cut(s) 113
MnlI CCTC 6 cut(s) 42, 120, 154, 208, 242, 317
MspI CCGG 3 cut(s) 20, 123, 211
MspR9I CCNGG 4 cut(s) 21, 115, 124, 212
MvaI CCWGG 1 cut(s) 115
NciI CCSGG 3 cut(s) 21, 124, 212
NdeII GATC 3 cut(s) 74, 85, 110
NlaIV GGNNCC 3 cut(s) 112, 131, 219
NspV TTCGAA 1 cut(s) 15
PaeR7I CTCGAG 4 cut(s) 153, 197, 240, 284
PfeI GAWTC 3 cut(s) 64, 158, 245
PfoI TCCNGGA 2 cut(s) 122, 210
PleI GAGTC 2 cut(s) 134, 222
PpsI GAGTC 2 cut(s) 134, 222
Psp6I CCWGG 1 cut(s) 113
PspGI CCWGG 1 cut(s) 113
PspN4I GGNNCC 3 cut(s) 112, 131, 219
PspPI GGNCC 4 cut(s) 120, 130, 208, 218
PsuI RGATCY 3 cut(s) 74, 85, 110
Rsr2I CGGWCCG 2 cut(s) 120, 208
RsrII CGGWCCG 2 cut(s) 120, 208
Sau3AI GATC 3 cut(s) 74, 85, 110
Sau96I GGNCC 4 cut(s) 120, 130, 208, 218
SchI GAGTC 2 cut(s) 134, 222
ScrFI CCNGG 4 cut(s) 21, 115, 124, 212
SduI GDGCHC 2 cut(s) 291, 332
SetI ASST 6 cut(s) 72, 192, 279, 296, 302, 335
Sfr274I CTCGAG 4 cut(s) 153, 197, 240, 284
SfuI TTCGAA 1 cut(s) 15
SinI GGWCC 4 cut(s) 120, 130, 208, 218
SlaI CTCGAG 4 cut(s) 153, 197, 240, 284
SmlI CTYRAG 4 cut(s) 153, 197, 240, 284
SmoI CTYRAG 4 cut(s) 153, 197, 240, 284
SsiI CCGC 2 cut(s) 118, 206
StyD4I CCNGG 4 cut(s) 19, 113, 122, 210
TaqI TCGA 5 cut(s) 15, 154, 198, 241, 285
TfiI GAWTC 3 cut(s) 64, 158, 245
VpaK11BI GGWCC 4 cut(s) 120, 130, 208, 218
XhoI CTCGAG 4 cut(s) 153, 197, 240, 284
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.