MD00G1155400.v1.1

ZINC FINGER protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0014232
Physical Location & Seq
Reverse (-)
34173753 .. 34174235
483 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1155400.v1.1.491

Sequence Viewer

Length: 267 bp
ATGGTGTATGATGGTCTGAAGAAGGCAGAGAAGGGGGCGAAGCCACTGCCTCAGGATCAGGACCTTCCTGGGATGGGCCAATACTACTGCCTACACTGCGACCGATATTTTAACAATGCGCTGGTGAGGGACGATCATTTCAAGACAAAGCGTCACAAGAAGCGTGTGAAGATAATGATGGGGGATGCACCTCACACTCAGCTGGACGCTGATTTAGCTACTGGGATGGGTATGCCAGATAATGGTCCCAAGCTTATGTCTTTTTGA

Protein Analysis

89

Amino Acids

10.0

Weight (kDa)

8.93

Isoelectric Point (pI)

34.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-C2H2_jaz PF12171 27 - 53 3.1e-10 Zinc-finger double-stranded RNA-binding
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014232)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G36930
fragaria_vesca FvH4_6g16440
malus_domestica MD00G1155400.v1.1 MD12G1112600.v1.1
prunus_persica Prupe.7G129700_v2.0.a1 Prupe.7G129700_v2.0.a1
pyrus_communis pycom04g08760
rosa_chinensis RchiOBHm_Chr3g0470301
rosa_laevigata RLG00000024280
rosa_multiflora Rmu_sc0002659.1_g000001
rosa_roxburghii Rroxscaffold_6G00410970
rosa_rugosa Rorug03G0108000
rosa_samantha Rh3AG157700 Rh3BG182000 Rh3CG172700 Rh3DG192900
rosa_wichuraiana Rw3G015000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 242
AclWI GGATC 1 cut(s) 63
AcuI CTGAAG 1 cut(s) 38
AfiI CCNNNNNNNGG 2 cut(s) 74, 242
AgsI TTSAA 1 cut(s) 142
AhdI GACNNNNNGTC 1 cut(s) 150
AjnI CCWGG 1 cut(s) 67
AluBI AGCT 3 cut(s) 202, 218, 253
AluI AGCT 3 cut(s) 202, 218, 253
AlwI GGATC 1 cut(s) 63
AoxI GGCC 1 cut(s) 76
AspLEI GCGC 1 cut(s) 121
AspS9I GGNCC 3 cut(s) 61, 76, 245
AsuHPI GGTGA 1 cut(s) 136
AvaII GGWCC 2 cut(s) 61, 245
AxyI CCTNAGG 1 cut(s) 51
BccI CCATC 4 cut(s) 5, 67, 172, 220
BcgI CGANNNNNNTGC 2 cut(s) 28, 62
BciT130I CCWGG 1 cut(s) 69
Bme1390I CCNGG 1 cut(s) 69
Bme18I GGWCC 2 cut(s) 61, 245
BmeRI GACNNNNNGTC 1 cut(s) 150
BmgT120I GGNCC 3 cut(s) 61, 76, 245
BmiI GGNNCC 1 cut(s) 247
BmrFI CCNGG 1 cut(s) 69
BmrI ACTGGG 1 cut(s) 231
BmsI GCATC 1 cut(s) 175
BmuI ACTGGG 1 cut(s) 231
BsaJI CCNNGG 1 cut(s) 68
Bsc4I CCNNNNNNNGG 2 cut(s) 74, 242
Bse1I ACTGG 1 cut(s) 226
Bse21I CCTNAGG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 68
BseGI GGATG 3 cut(s) 78, 190, 231
BseLI CCNNNNNNNGG 2 cut(s) 74, 242
BseMII CTCAG 2 cut(s) 65, 212
BseNI ACTGG 1 cut(s) 226
Bsh1285I CGRYCG 1 cut(s) 103
BshFI GGCC 1 cut(s) 78
BsiEI CGRYCG 1 cut(s) 103
BslFI GGGAC 2 cut(s) 143, 231
BslI CCNNNNNNNGG 2 cut(s) 74, 242
BsmFI GGGAC 2 cut(s) 143, 231
BsnI GGCC 1 cut(s) 78
Bsp143I GATC 2 cut(s) 55, 133
BspANI GGCC 1 cut(s) 78
BspCNI CTCAG 2 cut(s) 64, 211
BspLI GGNNCC 1 cut(s) 247
BspPI GGATC 1 cut(s) 63
BsrI ACTGG 1 cut(s) 226
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 2 cut(s) 55, 133
Bst2UI CCWGG 1 cut(s) 69
BstDEI CTNAG 2 cut(s) 51, 198
BstF5I GGATG 3 cut(s) 78, 190, 231
BstHHI GCGC 1 cut(s) 121
BstKTI GATC 2 cut(s) 58, 136
BstMBI GATC 2 cut(s) 55, 133
BstMCI CGRYCG 1 cut(s) 103
BstMWI GCNNNNNNNGC 2 cut(s) 96, 215
BstNI CCWGG 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 67
Bsu36I CCTNAGG 1 cut(s) 51
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 3 cut(s) 78, 190, 231
BtsI GCAGTG 2 cut(s) 44, 94
BtsIMutI CAGTG 2 cut(s) 44, 94
CfoI GCGC 1 cut(s) 121
Cfr13I GGNCC 3 cut(s) 61, 76, 245
CseI GACGC 2 cut(s) 140, 215
CviJI RGCY 5 cut(s) 43, 78, 202, 218, 253
CviKI_1 RGCY 5 cut(s) 43, 78, 202, 218, 253
DdeI CTNAG 2 cut(s) 51, 198
DpnI GATC 2 cut(s) 57, 135
DpnII GATC 2 cut(s) 55, 133
DriI GACNNNNNGTC 1 cut(s) 150
Eam1105I GACNNNNNGTC 1 cut(s) 150
Eco47I GGWCC 2 cut(s) 61, 245
Eco57I CTGAAG 1 cut(s) 38
Eco81I CCTNAGG 1 cut(s) 51
EcoO109I RGGNCCY 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 67
FaiI YATR 3 cut(s) 9, 233, 257
FaqI GGGAC 2 cut(s) 143, 231
FokI GGATG 3 cut(s) 85, 197, 238
GlaI GCGC 1 cut(s) 120
HaeIII GGCC 1 cut(s) 78
HgaI GACGC 2 cut(s) 140, 215
HhaI GCGC 1 cut(s) 121
Hin6I GCGC 1 cut(s) 119
HinP1I GCGC 1 cut(s) 119
HindIII AAGCTT 1 cut(s) 251
HphI GGTGA 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 3 cut(s) 53, 59, 142
HpyAV CCTTC 3 cut(s) 16, 25, 74
HpyCH4V TGCA 1 cut(s) 188
HpyF10VI GCNNNNNNNGC 2 cut(s) 96, 215
HpyF3I CTNAG 2 cut(s) 51, 198
HspAI GCGC 1 cut(s) 119
Kzo9I GATC 2 cut(s) 55, 133
LpnPI CCDG 8 cut(s) 38, 44, 54, 81, 107, 188, 207, 249
LweI GCATC 1 cut(s) 175
MaeIII GTNAC 1 cut(s) 152
MalI GATC 2 cut(s) 57, 135
MboI GATC 2 cut(s) 55, 133
MboII GAAGA 2 cut(s) 31, 181
MnlI CCTC 3 cut(s) 60, 120, 201
MseI TTAA 1 cut(s) 111
MspA1I CMGCKG 1 cut(s) 202
MspR9I CCNGG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 69
MwoI GCNNNNNNNGC 2 cut(s) 96, 215
NdeII GATC 2 cut(s) 55, 133
NlaIV GGNNCC 1 cut(s) 247
NmuCI GTSAC 1 cut(s) 152
PflMI CCANNNNNTGG 1 cut(s) 242
PpuMI RGGWCCY 1 cut(s) 61
Psp5II RGGWCCY 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 67
PspGI CCWGG 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 247
PspPI GGNCC 3 cut(s) 61, 76, 245
PspPPI RGGWCCY 1 cut(s) 61
PvuII CAGCTG 1 cut(s) 202
SaqAI TTAA 1 cut(s) 111
Sau3AI GATC 2 cut(s) 55, 133
Sau96I GGNCC 3 cut(s) 61, 76, 245
ScrFI CCNGG 1 cut(s) 69
SetI ASST 5 cut(s) 66, 193, 204, 220, 255
SfaNI GCATC 1 cut(s) 175
SinI GGWCC 2 cut(s) 61, 245
StyD4I CCNGG 1 cut(s) 67
TaqII GACCGA 1 cut(s) 117
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TscAI CASTG 2 cut(s) 51, 101
TseFI GTSAC 1 cut(s) 152
Tsp45I GTSAC 1 cut(s) 152
TspRI CASTG 2 cut(s) 51, 101
Van91I CCANNNNNTGG 1 cut(s) 242
VpaK11BI GGWCC 2 cut(s) 61, 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.