MD01G1006600.v1.1

Bacterial RNA polymerase, alpha chain C terminal domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Reverse (-)
2918684 .. 2918941
258 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1006600.v1.1.491

Sequence Viewer

Length: 258 bp
ATGGGAATGAGAAACAAGAGATACTTTTTTCTTAAAATATGGACAAATGGAAGTTTAACTCCTAAAGAAGCACTTCATGAAGCCTCCTGGAATTTGATGAATCTATTTATTCCTTTTTTACATGCAAAAGAAGAAAACTTACATTTAGAAAATAATCAATGCAAAGTGATTTTACCCCACTTTACTTGTCATGATAGATTGGCTAAAAAAAGGATAAATAATAAAGAAATCGCATTTAAATATATTTTTATTGACTAA

Protein Analysis

86

Amino Acids

10.23

Weight (kDa)

9.47

Isoelectric Point (pI)

26.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017060)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 91
AjnI CCWGG 1 cut(s) 86
ApoI RAATTY 1 cut(s) 91
Asp700I GAANNNNTTC 1 cut(s) 72
BarI GAAGNNNNNNTAC 2 cut(s) 123, 155
BciT130I CCWGG 1 cut(s) 88
Bme1390I CCNGG 1 cut(s) 88
BmrFI CCNGG 1 cut(s) 88
BseBI CCWGG 1 cut(s) 88
BspHI TCATGA 2 cut(s) 76, 190
Bst2UI CCWGG 1 cut(s) 88
BstNI CCWGG 1 cut(s) 88
BstNSI RCATGY 1 cut(s) 125
BstSCI CCNGG 1 cut(s) 86
CciI TCATGA 2 cut(s) 76, 190
CspCI CAANNNNNGTGG 2 cut(s) 167, 202
CviAII CATG 3 cut(s) 77, 122, 191
CviJI RGCY 2 cut(s) 83, 203
CviKI_1 RGCY 2 cut(s) 83, 203
DraI TTTAAA 1 cut(s) 238
EcoRII CCWGG 1 cut(s) 86
FaeI CATG 3 cut(s) 80, 125, 194
FaiI YATR 5 cut(s) 40, 78, 123, 192, 243
FalI AAGNNNNNCTT 4 cut(s) 8, 40, 57, 89
FatI CATG 3 cut(s) 76, 121, 190
Hin1II CATG 3 cut(s) 80, 125, 194
HinfI GANTC 1 cut(s) 100
Hpy188III TCNNGA 2 cut(s) 77, 191
HpyCH4V TGCA 2 cut(s) 125, 162
Hsp92II CATG 3 cut(s) 80, 125, 194
LpnPI CCDG 2 cut(s) 73, 100
MboII GAAGA 1 cut(s) 143
MluCI AATT 1 cut(s) 91
MnlI CCTC 1 cut(s) 94
MroXI GAANNNNTTC 1 cut(s) 72
MseI TTAA 3 cut(s) 33, 56, 237
MspR9I CCNGG 1 cut(s) 88
MvaI CCWGG 1 cut(s) 88
NlaIII CATG 3 cut(s) 80, 125, 194
NspI RCATGY 1 cut(s) 125
PagI TCATGA 2 cut(s) 76, 190
PdmI GAANNNNTTC 1 cut(s) 72
PfeI GAWTC 1 cut(s) 100
PfoI TCCNGGA 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 86
PspGI CCWGG 1 cut(s) 86
SaqAI TTAA 3 cut(s) 33, 56, 237
ScrFI CCNGG 1 cut(s) 88
SgeI CNNG 7 cut(s) 28, 89, 99, 100, 134, 198, 203
SmiI ATTTAAAT 1 cut(s) 238
Sse9I AATT 1 cut(s) 91
StyD4I CCNGG 1 cut(s) 86
SwaI ATTTAAAT 1 cut(s) 238
TasI AATT 1 cut(s) 91
TfiI GAWTC 1 cut(s) 100
Tru1I TTAA 3 cut(s) 33, 56, 237
Tru9I TTAA 3 cut(s) 33, 56, 237
TspDTI ATGAA 3 cut(s) 65, 93, 113
XapI RAATTY 1 cut(s) 91
XceI RCATGY 1 cut(s) 125
XmnI GAANNNNTTC 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.