MD01G1090100.v1.1

Protein of unknown function, DUF538

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0012173
Physical Location & Seq
Reverse (-)
20399008 .. 20399322
315 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1090100.v1.1.491

Sequence Viewer

Length: 315 bp
ATGTCCCTATTTAACACCCAGTTCTCCTTCTTCTTCCTCACAGTCTTTCCATTGACCTTTCTCCTCTTTCTCTCTCTATCCTTCTCTCTCTCCTCTACCAACATCCATGACCTCCTTATCTCCCATGGGCTGCCACCTGGCCTTCTCCCGAATGAGGTCAAGTCCTACACTCTTTCAAACAACAGGGAGCTCCAGGTCTTCCTTGATGCCCTATGCCTCACAAAATATGAGAATAGGGTTTTCTTTGAGAGTGTTTTAAGGGCAAATCTCAGCTATGAAAGTCTTATTGGGGTCGAGGGTTTATCTCAGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF538

Protein Analysis

105

Amino Acids

11.83

Weight (kDa)

4.98

Isoelectric Point (pI)

36.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF538 PF04398 35 - 103 6.4e-12 Protein of unknown function, DUF538
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012173)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G54530
fragaria_vesca FvH4_3g21500
malus_domestica MD01G1090100.v1.1 MD03G1215600.v1.1 MD11G1230200.v1.1
prunus_persica Prupe.4G197200_v2.0.a1
pyrus_communis pycom03g16400 pycom11g20400
rosa_chinensis RchiOBHm_Chr5g0036931
rosa_laevigata RLG00000033735
rosa_multiflora Rmu_sc0007663.1_g000018
rosa_roxburghii Rroxscaffold_1G00044020
rosa_rugosa Rorug05G0159000 Rorug05G0159100
rosa_samantha Rh5AG251300 Rh5BG252800 Rh5CG285400 Rh5DG261400
rosa_wichuraiana Rw5G023120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 1 cut(s) 177
AjnI CCWGG 2 cut(s) 136, 192
AjuI GAANNNNNNNTTGG 2 cut(s) 270, 302
AluBI AGCT 2 cut(s) 190, 273
AluI AGCT 2 cut(s) 190, 273
Alw21I GWGCWC 1 cut(s) 192
AoxI GGCC 1 cut(s) 139
ApeKI GCWGC 1 cut(s) 130
BanII GRGCYC 1 cut(s) 192
BbsI GAAGAC 1 cut(s) 190
Bbv12I GWGCWC 1 cut(s) 192
BbvI GCAGC 1 cut(s) 117
BciT130I CCWGG 2 cut(s) 138, 194
BisI GCNGC 1 cut(s) 131
BlsI GCNGC 1 cut(s) 132
Bme1390I CCNGG 2 cut(s) 138, 194
BmrFI CCNGG 2 cut(s) 138, 194
BmrI ACTGGG 1 cut(s) 13
BmsI GCATC 1 cut(s) 196
BmuI ACTGGG 1 cut(s) 13
BpiI GAAGAC 1 cut(s) 190
BpmI CTGGAG 1 cut(s) 176
BsaJI CCNNGG 1 cut(s) 124
Bsc4I CCNNNNNNNGG 1 cut(s) 154
Bse1I ACTGG 1 cut(s) 19
BseBI CCWGG 2 cut(s) 138, 194
BseDI CCNNGG 1 cut(s) 124
BseGI GGATG 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 154
BseMII CTCAG 1 cut(s) 283
BseNI ACTGG 1 cut(s) 19
BseRI GAGGAG 2 cut(s) 53, 82
BseXI GCAGC 1 cut(s) 117
BshFI GGCC 1 cut(s) 141
BsiHKAI GWGCWC 1 cut(s) 192
BslI CCNNNNNNNGG 1 cut(s) 154
BsnI GGCC 1 cut(s) 141
Bsp1286I GDGCHC 1 cut(s) 192
Bsp19I CCATGG 1 cut(s) 124
BspANI GGCC 1 cut(s) 141
BspCNI CTCAG 1 cut(s) 282
BsrI ACTGG 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 124
BssT1I CCWWGG 1 cut(s) 124
Bst2UI CCWGG 2 cut(s) 138, 194
Bst4CI ACNGT 1 cut(s) 43
BstDEI CTNAG 2 cut(s) 269, 306
BstDSI CCRYGG 1 cut(s) 124
BstF5I GGATG 1 cut(s) 102
BstNI CCWGG 2 cut(s) 138, 194
BstSCI CCNGG 2 cut(s) 136, 192
BstV1I GCAGC 1 cut(s) 117
BstV2I GAAGAC 1 cut(s) 190
BsuRI GGCC 1 cut(s) 141
BtgI CCRYGG 1 cut(s) 124
BtsCI GGATG 1 cut(s) 102
CviAII CATG 2 cut(s) 107, 125
CviJI RGCY 4 cut(s) 130, 141, 190, 273
CviKI_1 RGCY 4 cut(s) 130, 141, 190, 273
DdeI CTNAG 2 cut(s) 269, 306
Ecl136II GAGCTC 1 cut(s) 190
Eco130I CCWWGG 1 cut(s) 124
Eco24I GRGCYC 1 cut(s) 192
Eco53kI GAGCTC 1 cut(s) 190
EcoICRI GAGCTC 1 cut(s) 190
EcoRII CCWGG 2 cut(s) 136, 192
EcoT14I CCWWGG 1 cut(s) 124
EcoT38I GRGCYC 1 cut(s) 192
ErhI CCWWGG 1 cut(s) 124
FaeI CATG 2 cut(s) 110, 128
FaiI YATR 5 cut(s) 108, 126, 214, 228, 276
FatI CATG 2 cut(s) 106, 124
Fnu4HI GCNGC 1 cut(s) 131
FokI GGATG 1 cut(s) 89
FriOI GRGCYC 1 cut(s) 192
Fsp4HI GCNGC 1 cut(s) 131
GluI GCNGC 1 cut(s) 131
GsuI CTGGAG 1 cut(s) 176
HaeIII GGCC 1 cut(s) 141
Hin1II CATG 2 cut(s) 110, 128
Hpy188III TCNNGA 2 cut(s) 148, 308
HpyAV CCTTC 3 cut(s) 37, 91, 152
HpyCH4III ACNGT 1 cut(s) 43
HpyF3I CTNAG 2 cut(s) 269, 306
Hsp92II CATG 2 cut(s) 110, 128
LmnI GCTCC 2 cut(s) 187, 195
LpnPI CCDG 7 cut(s) 32, 123, 150, 169, 179, 206, 293
Lsp1109I GCAGC 1 cut(s) 117
LweI GCATC 1 cut(s) 196
MboII GAAGA 3 cut(s) 22, 25, 190
MhlI GDGCHC 1 cut(s) 192
MnlI CCTC 7 cut(s) 47, 74, 103, 122, 148, 227, 289
MseI TTAA 2 cut(s) 12, 257
MspR9I CCNGG 2 cut(s) 138, 194
MvaI CCWGG 2 cut(s) 138, 194
NcoI CCATGG 1 cut(s) 124
NlaIII CATG 2 cut(s) 110, 128
PkrI GCNGC 1 cut(s) 132
Psp124BI GAGCTC 1 cut(s) 192
Psp6I CCWGG 2 cut(s) 136, 192
PspGI CCWGG 2 cut(s) 136, 192
SacI GAGCTC 1 cut(s) 192
SaqAI TTAA 2 cut(s) 12, 257
SatI GCNGC 1 cut(s) 131
ScrFI CCNGG 2 cut(s) 138, 194
SduI GDGCHC 1 cut(s) 192
SetI ASST 7 cut(s) 59, 114, 139, 159, 192, 198, 275
SfaNI GCATC 1 cut(s) 196
SstI GAGCTC 1 cut(s) 192
StyD4I CCNGG 2 cut(s) 136, 192
StyI CCWWGG 1 cut(s) 124
TaaI ACNGT 1 cut(s) 43
TaqI TCGA 1 cut(s) 294
Tru1I TTAA 2 cut(s) 12, 257
Tru9I TTAA 2 cut(s) 12, 257
TseI GCWGC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.