Rorug05G0159100

Protein of unknown function, DUF538

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
14782339 .. 14874434
92096 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0159100.1

Sequence Viewer

Length: 366 bp
ATGGCGAAGTCGATGAGATGCAAGAGAGAGAAGAGGCTTCGGGCTATTCGCAGAGAGATGGTAGAGCCCTACTACGAGAAGAAAGACGAGGCCAAGCTCGCTGCCCAAGAAGCTGCCCTCGCTGCCCCTAAGCTGCCCGTAAAGCCCTCTTCTAAGGCCTCCTCTTCTATGGAGATCGCCCCCGTCAACACCTCAACGCCTTCTGAAAACGCCATGGATGTGGAGATGGCTGATGGCAGTCAGACAAAGAGTTCATTAAAGCCTTTTGGTGGGGTGGGTAAGAAATCCCAACGGGTGTTCAAGGTGGGCAAGAGAAGGCGTCATGGCAAGGGCAAGGGCGGAAAGGTTAAGAGGCGTCATATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

13.4

Weight (kDa)

10.58

Isoelectric Point (pI)

65.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012173)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 339
AcyI GRCGYC 2 cut(s) 319, 355
AfiI CCNNNNNNNGG 1 cut(s) 269
AgsI TTSAA 1 cut(s) 301
AluBI AGCT 3 cut(s) 97, 113, 133
AluI AGCT 3 cut(s) 97, 113, 133
AoxI GGCC 2 cut(s) 90, 156
ApeKI GCWGC 4 cut(s) 101, 113, 122, 133
BanII GRGCYC 1 cut(s) 69
BbvI GCAGC 4 cut(s) 88, 100, 109, 120
BccI CCATC 3 cut(s) 52, 220, 227
BisI GCNGC 4 cut(s) 102, 114, 123, 134
BlsI GCNGC 4 cut(s) 103, 115, 124, 135
BmsI GCATC 1 cut(s) 8
Bpu10I CCTNAGC 1 cut(s) 129
BsaHI GRCGYC 2 cut(s) 319, 355
BsaJI CCNNGG 1 cut(s) 213
Bsc4I CCNNNNNNNGG 1 cut(s) 269
BseDI CCNNGG 1 cut(s) 213
BseGI GGATG 1 cut(s) 223
BseLI CCNNNNNNNGG 1 cut(s) 269
BseRI GAGGAG 1 cut(s) 151
BseXI GCAGC 4 cut(s) 88, 100, 109, 120
BshFI GGCC 2 cut(s) 92, 158
BslI CCNNNNNNNGG 1 cut(s) 269
BsnI GGCC 2 cut(s) 92, 158
Bsp1286I GDGCHC 1 cut(s) 69
Bsp143I GATC 1 cut(s) 174
Bsp19I CCATGG 1 cut(s) 213
BspACI CCGC 1 cut(s) 339
BspANI GGCC 2 cut(s) 92, 158
BssECI CCNNGG 1 cut(s) 213
BssMI GATC 1 cut(s) 174
BssNI GRCGYC 2 cut(s) 319, 355
BssT1I CCWWGG 1 cut(s) 213
Bst6I CTCTTC 3 cut(s) 26, 154, 169
BstACI GRCGYC 2 cut(s) 319, 355
BstC8I GCNNGC 1 cut(s) 99
BstDEI CTNAG 2 cut(s) 129, 153
BstDSI CCRYGG 1 cut(s) 213
BstF5I GGATG 1 cut(s) 223
BstKTI GATC 1 cut(s) 177
BstMBI GATC 1 cut(s) 174
BstMWI GCNNNNNNNGC 5 cut(s) 98, 110, 119, 122, 142
BstV1I GCAGC 4 cut(s) 88, 100, 109, 120
BstXI CCANNNNNNTGG 1 cut(s) 220
BsuRI GGCC 2 cut(s) 92, 158
BtgI CCRYGG 1 cut(s) 213
BtsCI GGATG 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 99
CseI GACGC 2 cut(s) 308, 344
CviAII CATG 2 cut(s) 214, 323
DdeI CTNAG 2 cut(s) 129, 153
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
Eam1104I CTCTTC 3 cut(s) 26, 154, 169
EarI CTCTTC 3 cut(s) 26, 154, 169
EciI GGCGGA 1 cut(s) 354
Eco130I CCWWGG 1 cut(s) 213
Eco147I AGGCCT 1 cut(s) 158
Eco24I GRGCYC 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 213
EcoT38I GRGCYC 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 213
FaeI CATG 2 cut(s) 217, 326
FaiI YATR 4 cut(s) 170, 215, 324, 360
FatI CATG 2 cut(s) 213, 322
Fnu4HI GCNGC 4 cut(s) 102, 114, 123, 134
FokI GGATG 1 cut(s) 230
FriOI GRGCYC 1 cut(s) 69
Fsp4HI GCNGC 4 cut(s) 102, 114, 123, 134
GluI GCNGC 4 cut(s) 102, 114, 123, 134
HaeIII GGCC 2 cut(s) 92, 158
HgaI GACGC 2 cut(s) 308, 344
Hin1I GRCGYC 2 cut(s) 319, 355
Hin1II CATG 2 cut(s) 217, 326
HincII GTYRAC 1 cut(s) 187
HindII GTYRAC 1 cut(s) 187
Hpy166II GTNNAC 1 cut(s) 187
Hpy188I TCNGA 3 cut(s) 205, 243, 365
Hpy8I GTNNAC 1 cut(s) 187
HpyAV CCTTC 2 cut(s) 210, 309
HpyCH4V TGCA 1 cut(s) 21
HpyF10VI GCNNNNNNNGC 5 cut(s) 98, 110, 119, 122, 142
HpyF3I CTNAG 2 cut(s) 129, 153
Hsp92I GRCGYC 2 cut(s) 319, 355
Hsp92II CATG 2 cut(s) 217, 326
Kzo9I GATC 1 cut(s) 174
Lsp1109I GCAGC 4 cut(s) 88, 100, 109, 120
LweI GCATC 1 cut(s) 8
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MboII GAAGA 4 cut(s) 43, 91, 141, 156
MhlI GDGCHC 1 cut(s) 69
MnlI CCTC 8 cut(s) 27, 82, 128, 157, 169, 172, 202, 345
MseI TTAA 2 cut(s) 257, 348
MslI CAYNNNNRTG 1 cut(s) 218
MwoI GCNNNNNNNGC 5 cut(s) 98, 110, 119, 122, 142
NcoI CCATGG 1 cut(s) 213
NdeII GATC 1 cut(s) 174
NlaIII CATG 2 cut(s) 217, 326
PceI AGGCCT 1 cut(s) 158
PkrI GCNGC 4 cut(s) 103, 115, 124, 135
RseI CAYNNNNRTG 1 cut(s) 218
SaqAI TTAA 2 cut(s) 257, 348
SatI GCNGC 4 cut(s) 102, 114, 123, 134
Sau3AI GATC 1 cut(s) 174
SduI GDGCHC 1 cut(s) 69
SetI ASST 6 cut(s) 99, 115, 135, 194, 306, 348
SfaNI GCATC 1 cut(s) 8
SmiMI CAYNNNNRTG 1 cut(s) 218
SseBI AGGCCT 1 cut(s) 158
SsiI CCGC 1 cut(s) 339
StuI AGGCCT 1 cut(s) 158
StyI CCWWGG 1 cut(s) 213
TaqI TCGA 1 cut(s) 11
Tru1I TTAA 2 cut(s) 257, 348
Tru9I TTAA 2 cut(s) 257, 348
TseI GCWGC 4 cut(s) 101, 113, 122, 133
TspDTI ATGAA 1 cut(s) 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.