MD02G1047700.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
3779818 .. 3780347
530 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1047700.v1.1.491

Sequence Viewer

Length: 210 bp
ATGTCTCTTACACCATTGATGTTTAGGCCTCTGCTGAGGCTGCTAACATCCTTAGCTACCGATCCTGCTGCCTCAGTTTCGACGGTGCTCTACTACAGCGAGCTTCTTCCGCAGAACATCATCCTCGAAAGATTGGTTCGACACGAACTGCTCGATCGCGAAAATTACCTGTTCCATTTCCTCATCAACTTTTTGAGATGTTTTTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.23

Weight (kDa)

6.71

Isoelectric Point (pI)

44.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016724)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 159
AciI CCGC 1 cut(s) 110
AclWI GGATC 1 cut(s) 56
AluBI AGCT 2 cut(s) 56, 103
AluI AGCT 2 cut(s) 56, 103
Alw21I GWGCWC 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 1 cut(s) 56
AoxI GGCC 1 cut(s) 26
ApeKI GCWGC 2 cut(s) 40, 68
Bbv12I GWGCWC 1 cut(s) 90
BbvCI CCTCAGC 1 cut(s) 35
BbvI GCAGC 2 cut(s) 27, 55
BcgI CGANNNNNNTGC 2 cut(s) 50, 84
BcoDI GTCTC 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 94
BisI GCNGC 2 cut(s) 41, 69
BlsI GCNGC 2 cut(s) 42, 70
Bpu10I CCTNAGC 2 cut(s) 35, 52
BseGI GGATG 2 cut(s) 47, 120
BseMII CTCAG 2 cut(s) 26, 87
BseXI GCAGC 2 cut(s) 27, 55
Bsh1236I CGCG 1 cut(s) 159
Bsh1285I CGRYCG 1 cut(s) 157
BshFI GGCC 1 cut(s) 28
BsiEI CGRYCG 1 cut(s) 157
BsiHKAI GWGCWC 1 cut(s) 90
BsmAI GTCTC 1 cut(s) 9
BsnI GGCC 1 cut(s) 28
Bsp1286I GDGCHC 1 cut(s) 90
Bsp143I GATC 2 cut(s) 61, 154
Bsp68I TCGCGA 1 cut(s) 159
BspACI CCGC 1 cut(s) 110
BspANI GGCC 1 cut(s) 28
BspCNI CTCAG 2 cut(s) 27, 86
BspFNI CGCG 1 cut(s) 159
BspPI GGATC 1 cut(s) 56
BssMI GATC 2 cut(s) 61, 154
Bst4CI ACNGT 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 101
BstDEI CTNAG 3 cut(s) 35, 52, 73
BstF5I GGATG 2 cut(s) 47, 120
BstFNI CGCG 1 cut(s) 159
BstKTI GATC 2 cut(s) 64, 157
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 2 cut(s) 61, 154
BstMCI CGRYCG 1 cut(s) 157
BstMWI GCNNNNNNNGC 2 cut(s) 40, 109
BstSFI CTRYAG 1 cut(s) 94
BstUI CGCG 1 cut(s) 159
BstV1I GCAGC 2 cut(s) 27, 55
BsuRI GGCC 1 cut(s) 28
BtsCI GGATG 2 cut(s) 47, 120
BtuMI TCGCGA 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 101
CviJI RGCY 4 cut(s) 28, 40, 56, 103
CviKI_1 RGCY 4 cut(s) 28, 40, 56, 103
DdeI CTNAG 3 cut(s) 35, 52, 73
DpnI GATC 2 cut(s) 63, 156
DpnII GATC 2 cut(s) 61, 154
Eco147I AGGCCT 1 cut(s) 28
Fnu4HI GCNGC 2 cut(s) 41, 69
FokI GGATG 2 cut(s) 34, 107
Fsp4HI GCNGC 2 cut(s) 41, 69
GluI GCNGC 2 cut(s) 41, 69
HaeIII GGCC 1 cut(s) 28
Hpy188III TCNNGA 1 cut(s) 158
Hpy99I CGWCG 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 85
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 109
HpyF3I CTNAG 3 cut(s) 35, 52, 73
Kzo9I GATC 2 cut(s) 61, 154
LpnPI CCDG 2 cut(s) 78, 182
Lsp1109I GCAGC 2 cut(s) 27, 55
MalI GATC 2 cut(s) 63, 156
MboI GATC 2 cut(s) 61, 154
MboII GAAGA 1 cut(s) 98
MhlI GDGCHC 1 cut(s) 90
MluCI AATT 1 cut(s) 163
MnlI CCTC 5 cut(s) 30, 39, 82, 134, 191
MvnI CGCG 1 cut(s) 159
MwoI GCNNNNNNNGC 2 cut(s) 40, 109
NdeII GATC 2 cut(s) 61, 154
NruI TCGCGA 1 cut(s) 159
PceI AGGCCT 1 cut(s) 28
PcsI WCGNNNNNNNCGW 1 cut(s) 150
PkrI GCNGC 2 cut(s) 42, 70
Ple19I CGATCG 1 cut(s) 157
PvuI CGATCG 1 cut(s) 157
RruI TCGCGA 1 cut(s) 159
SatI GCNGC 2 cut(s) 41, 69
Sau3AI GATC 2 cut(s) 61, 154
SduI GDGCHC 1 cut(s) 90
SetI ASST 3 cut(s) 58, 105, 171
SfcI CTRYAG 1 cut(s) 94
SgeI CNNG 7 cut(s) 77, 112, 137, 155, 164, 170, 181
Sse9I AATT 1 cut(s) 163
SseBI AGGCCT 1 cut(s) 28
SsiI CCGC 1 cut(s) 110
StuI AGGCCT 1 cut(s) 28
TaaI ACNGT 1 cut(s) 85
TaqI TCGA 4 cut(s) 80, 126, 139, 153
TasI AATT 1 cut(s) 163
TseI GCWGC 2 cut(s) 40, 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.