MD15G1186200.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
14704763 .. 14705536
774 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1186200.v1.1.491

Sequence Viewer

Length: 210 bp
ATGTCTCTTACACCGTTGATGTTTAGGACACTGCTGAGGCTGCTAACATCCTTAATCGGAGATCCTGCTGCCTCAGTTTCGACTTTACTCTATTACAGTGAGTTGCTTCCGCAGAACATCATCCTCCAAAGATTGGTTCGACACGAACTGCTCGATGGAGAAAATTACCTGTTCCATTTCCTCATCAACTTTTTGCGATGTTTTTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.14

Weight (kDa)

6.7

Isoelectric Point (pI)

46.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016724)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 133
AciI CCGC 1 cut(s) 110
AclWI GGATC 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 133
AjuI GAANNNNNNNTTGG 2 cut(s) 120, 152
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 1 cut(s) 56
ApeKI GCWGC 2 cut(s) 40, 68
BbvCI CCTCAGC 1 cut(s) 35
BbvI GCAGC 2 cut(s) 27, 55
BccI CCATC 1 cut(s) 149
BcoDI GTCTC 1 cut(s) 9
BisI GCNGC 2 cut(s) 41, 69
BlsI GCNGC 2 cut(s) 42, 70
Bpu10I CCTNAGC 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 133
BseGI GGATG 2 cut(s) 47, 120
BseLI CCNNNNNNNGG 1 cut(s) 133
BseMII CTCAG 2 cut(s) 26, 87
BseXI GCAGC 2 cut(s) 27, 55
BslI CCNNNNNNNGG 1 cut(s) 133
BsmAI GTCTC 1 cut(s) 9
Bsp143I GATC 1 cut(s) 61
BspACI CCGC 1 cut(s) 110
BspCNI CTCAG 2 cut(s) 27, 86
BspPI GGATC 1 cut(s) 56
BssMI GATC 1 cut(s) 61
Bst4CI ACNGT 2 cut(s) 15, 98
BstDEI CTNAG 2 cut(s) 35, 73
BstF5I GGATG 2 cut(s) 47, 120
BstKTI GATC 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 40
BstV1I GCAGC 2 cut(s) 27, 55
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BtsCI GGATG 2 cut(s) 47, 120
BtsI GCAGTG 1 cut(s) 29
BtsIMutI CAGTG 2 cut(s) 29, 103
CviJI RGCY 1 cut(s) 40
CviKI_1 RGCY 1 cut(s) 40
DdeI CTNAG 2 cut(s) 35, 73
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Fnu4HI GCNGC 2 cut(s) 41, 69
FokI GGATG 2 cut(s) 34, 107
Fsp4HI GCNGC 2 cut(s) 41, 69
GluI GCNGC 2 cut(s) 41, 69
Hpy188I TCNGA 1 cut(s) 59
HpyCH4III ACNGT 2 cut(s) 15, 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
HpyF3I CTNAG 2 cut(s) 35, 73
Kzo9I GATC 1 cut(s) 61
LpnPI CCDG 2 cut(s) 78, 182
Lsp1109I GCAGC 2 cut(s) 27, 55
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MflI RGATCY 1 cut(s) 61
MluCI AATT 1 cut(s) 163
MnlI CCTC 4 cut(s) 30, 82, 134, 191
MseI TTAA 1 cut(s) 53
MwoI GCNNNNNNNGC 1 cut(s) 40
NdeII GATC 1 cut(s) 61
PcsI WCGNNNNNNNCGW 1 cut(s) 150
PflMI CCANNNNNTGG 1 cut(s) 133
PkrI GCNGC 2 cut(s) 42, 70
PsuI RGATCY 1 cut(s) 61
SaqAI TTAA 1 cut(s) 53
SatI GCNGC 2 cut(s) 41, 69
Sau3AI GATC 1 cut(s) 61
SetI ASST 1 cut(s) 171
SgeI CNNG 4 cut(s) 77, 155, 164, 181
Sse9I AATT 1 cut(s) 163
SsiI CCGC 1 cut(s) 110
TaaI ACNGT 2 cut(s) 15, 98
TaqI TCGA 3 cut(s) 80, 139, 153
TasI AATT 1 cut(s) 163
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TscAI CASTG 2 cut(s) 36, 103
TseI GCWGC 2 cut(s) 40, 68
TspRI CASTG 2 cut(s) 36, 103
Van91I CCANNNNNTGG 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.