MD03G1017500.v1.1

X-Pro dipeptidyl-peptidase (S15 family)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
Physical Location & Seq
Forward (+)
1375880 .. 1376863
984 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1017500.v1.1.491

Sequence Viewer

Length: 243 bp
ATGAGAGGGGTTGGGAGGTCAACAGGGAGGGCCTCTCTCACTGGGTTTGCAGAAATTAAGGATGTGATTGCTGTGTGCAAATGGGTTTCTGAGAATCTATCAGCTGACATGATTTTGTTGGTGGGTTCTTCTGCAGCCTCTCGCTGCTGCTCCTTAACTTGTTCTGAATTGCAATTTTTGGTTATTGATGTCTTGTTTATGCTCTCCAGTAATTGCAATATGAACATCGACGCGAGGACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

81

Amino Acids

8.58

Weight (kDa)

6.07

Isoelectric Point (pI)

31.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017736)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 233
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 30
ApeKI GCWGC 3 cut(s) 134, 144, 147
AspS9I GGNCC 1 cut(s) 30
BbvI GCAGC 3 cut(s) 131, 134, 146
BfmI CTRYAG 1 cut(s) 132
BisI GCNGC 3 cut(s) 135, 145, 148
BlsI GCNGC 3 cut(s) 136, 146, 149
BmgT120I GGNCC 1 cut(s) 30
BmrI ACTGGG 1 cut(s) 51
BmuI ACTGGG 1 cut(s) 51
BplI GAGNNNNNCTC 2 cut(s) 19, 51
BpmI CTGGAG 1 cut(s) 190
Bse1I ACTGG 2 cut(s) 46, 207
BseGI GGATG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 2 cut(s) 46, 207
BseXI GCAGC 3 cut(s) 131, 134, 146
Bsh1236I CGCG 1 cut(s) 233
BshFI GGCC 1 cut(s) 32
BsnI GGCC 1 cut(s) 32
BspANI GGCC 1 cut(s) 32
BspCNI CTCAG 1 cut(s) 82
BspFNI CGCG 1 cut(s) 233
BspMAI CTGCAG 1 cut(s) 136
BsrI ACTGG 2 cut(s) 46, 207
BstDEI CTNAG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 67
BstFNI CGCG 1 cut(s) 233
BstSFI CTRYAG 1 cut(s) 132
BstUI CGCG 1 cut(s) 233
BstV1I GCAGC 3 cut(s) 131, 134, 146
BsuRI GGCC 1 cut(s) 32
BtsCI GGATG 1 cut(s) 67
BtsIMutI CAGTG 1 cut(s) 39
Cfr13I GGNCC 1 cut(s) 30
CviAII CATG 1 cut(s) 109
CviJI RGCY 3 cut(s) 32, 104, 137
CviKI_1 RGCY 3 cut(s) 32, 104, 137
DdeI CTNAG 1 cut(s) 90
EcoO109I RGGNCCY 1 cut(s) 30
FaeI CATG 1 cut(s) 112
FaiI YATR 4 cut(s) 110, 200, 221, 241
FatI CATG 1 cut(s) 108
Fnu4HI GCNGC 3 cut(s) 135, 145, 148
FokI GGATG 1 cut(s) 74
Fsp4HI GCNGC 3 cut(s) 135, 145, 148
GluI GCNGC 3 cut(s) 135, 145, 148
GsuI CTGGAG 1 cut(s) 190
HaeIII GGCC 1 cut(s) 32
Hin1II CATG 1 cut(s) 112
HincII GTYRAC 1 cut(s) 21
HindII GTYRAC 1 cut(s) 21
HinfI GANTC 1 cut(s) 94
Hpy166II GTNNAC 1 cut(s) 21
Hpy188I TCNGA 2 cut(s) 91, 166
Hpy8I GTNNAC 1 cut(s) 21
Hpy99I CGWCG 1 cut(s) 233
HpyCH4V TGCA 5 cut(s) 50, 78, 134, 172, 216
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 1 cut(s) 112
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 3 cut(s) 9, 27, 220
Lsp1109I GCAGC 3 cut(s) 131, 134, 146
MboII GAAGA 1 cut(s) 120
MluCI AATT 4 cut(s) 54, 167, 173, 211
MnlI CCTC 5 cut(s) 9, 21, 43, 148, 228
MseI TTAA 2 cut(s) 57, 155
MspA1I CMGCKG 1 cut(s) 104
MvnI CGCG 1 cut(s) 233
NlaIII CATG 1 cut(s) 112
PfeI GAWTC 1 cut(s) 94
PkrI GCNGC 3 cut(s) 136, 146, 149
PspPI GGNCC 1 cut(s) 30
PstI CTGCAG 1 cut(s) 136
PvuII CAGCTG 1 cut(s) 104
SaqAI TTAA 2 cut(s) 57, 155
SatI GCNGC 3 cut(s) 135, 145, 148
Sau96I GGNCC 1 cut(s) 30
SetI ASST 2 cut(s) 20, 106
SfcI CTRYAG 1 cut(s) 132
SgeI CNNG 7 cut(s) 36, 54, 121, 153, 171, 205, 219
Sse9I AATT 4 cut(s) 54, 167, 173, 211
TaqI TCGA 1 cut(s) 228
TasI AATT 4 cut(s) 54, 167, 173, 211
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 2 cut(s) 57, 155
Tru9I TTAA 2 cut(s) 57, 155
TscAI CASTG 1 cut(s) 46
TseI GCWGC 3 cut(s) 134, 144, 147
TspDTI ATGAA 1 cut(s) 236
TspRI CASTG 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.