Rmu_sc0012263.1_g000001

X-Pro dipeptidyl-peptidase (S15 family)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012263.1
Physical Location & Seq
Forward (+)
800 .. 1513
714 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012263.1_g000001.1.cds

Sequence Viewer

Length: 501 bp
atgacaacctccgaatctcacactccagctgagaaaggtttcaaagttgtcacttttgacatgagaggagttgggaggtcaactgggaaggcttttcttactgggtttgtagaaatcaaggatgtgattactggctgcaaattggtctctaagaatttgtctgctaatagaattttgcttgtgggttcttctacaggtatggtattcttgtatcgatggggctcttggttcatgcacttgacccttcactgctcttctcagatgacaacctccgaatctcacactccagccgagaaaggtttcaaagctgtcacttttgacatgagaggagttgggaggtcaactgggaaggcttctcttactgggtttgtagaaatcaaggatgtgattactggctgcaaattggtctctaagaatttgtctgctaatagaattttgcttgtgggttcttctacaggtggtcgattttgtggatctgtagattgtattcagcagcaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

166

Amino Acids

17.88

Weight (kDa)

9.63

Isoelectric Point (pI)

25.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017736)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 481
AcsI RAATTY 4 cut(s) 154, 171, 415, 432
AgsI TTSAA 2 cut(s) 43, 304
AluBI AGCT 2 cut(s) 29, 308
AluI AGCT 2 cut(s) 29, 308
Alw26I GTCTC 2 cut(s) 151, 412
AlwI GGATC 1 cut(s) 481
ApeKI GCWGC 3 cut(s) 135, 396, 493
ApoI RAATTY 4 cut(s) 154, 171, 415, 432
Asp700I GAANNNNTTC 2 cut(s) 38, 299
BanII GRGCYC 1 cut(s) 224
BbvI GCAGC 2 cut(s) 122, 383
BccI CCATC 1 cut(s) 210
BcoDI GTCTC 2 cut(s) 151, 412
BfmI CTRYAG 3 cut(s) 192, 453, 477
BisI GCNGC 3 cut(s) 136, 397, 494
BlsI GCNGC 3 cut(s) 137, 398, 495
BmrI ACTGGG 4 cut(s) 93, 111, 354, 372
BmuI ACTGGG 4 cut(s) 93, 111, 354, 372
BpmI CTGGAG 2 cut(s) 9, 270
Bsa29I ATCGAT 1 cut(s) 214
BsaI GGTCTC 2 cut(s) 151, 412
Bse1I ACTGG 6 cut(s) 88, 106, 136, 349, 367, 397
BseCI ATCGAT 1 cut(s) 214
BseGI GGATG 2 cut(s) 127, 388
BseMII CTCAG 2 cut(s) 21, 272
BseNI ACTGG 6 cut(s) 88, 106, 136, 349, 367, 397
BseRI GAGGAG 2 cut(s) 81, 342
BseXI GCAGC 2 cut(s) 122, 383
BshVI ATCGAT 1 cut(s) 214
BsmAI GTCTC 2 cut(s) 151, 412
Bso31I GGTCTC 2 cut(s) 151, 412
Bsp1286I GDGCHC 1 cut(s) 224
Bsp143I GATC 1 cut(s) 473
BspCNI CTCAG 2 cut(s) 22, 271
BspDI ATCGAT 1 cut(s) 214
BspPI GGATC 1 cut(s) 481
BspQI GCTCTTC 1 cut(s) 259
BspTNI GGTCTC 2 cut(s) 151, 412
BsrI ACTGG 6 cut(s) 88, 106, 136, 349, 367, 397
BssMI GATC 1 cut(s) 473
Bst6I CTCTTC 1 cut(s) 259
BstDEI CTNAG 4 cut(s) 30, 150, 258, 411
BstF5I GGATG 2 cut(s) 127, 388
BstKTI GATC 1 cut(s) 476
BstMAI GTCTC 2 cut(s) 151, 412
BstMBI GATC 1 cut(s) 473
BstSFI CTRYAG 3 cut(s) 192, 453, 477
BstV1I GCAGC 2 cut(s) 122, 383
BstX2I RGATCY 1 cut(s) 473
BstYI RGATCY 1 cut(s) 473
Bsu15I ATCGAT 1 cut(s) 214
BsuTUI ATCGAT 1 cut(s) 214
BtsCI GGATG 2 cut(s) 127, 388
BtsI GCAGTG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 247
ClaI ATCGAT 1 cut(s) 214
CviAII CATG 3 cut(s) 61, 232, 322
CviJI RGCY 8 cut(s) 29, 92, 135, 222, 290, 308, 353, 396
CviKI_1 RGCY 8 cut(s) 29, 92, 135, 222, 290, 308, 353, 396
DdeI CTNAG 4 cut(s) 30, 150, 258, 411
DpnI GATC 1 cut(s) 475
DpnII GATC 1 cut(s) 473
Eam1104I CTCTTC 1 cut(s) 259
EarI CTCTTC 1 cut(s) 259
Eco24I GRGCYC 1 cut(s) 224
Eco31I GGTCTC 2 cut(s) 151, 412
EcoT38I GRGCYC 1 cut(s) 224
FaeI CATG 3 cut(s) 64, 235, 325
FaiI YATR 4 cut(s) 62, 200, 233, 323
FatI CATG 3 cut(s) 60, 231, 321
Fnu4HI GCNGC 3 cut(s) 136, 397, 494
FokI GGATG 2 cut(s) 134, 395
FriOI GRGCYC 1 cut(s) 224
Fsp4HI GCNGC 3 cut(s) 136, 397, 494
GluI GCNGC 3 cut(s) 136, 397, 494
GsuI CTGGAG 2 cut(s) 9, 270
Hin1II CATG 3 cut(s) 64, 235, 325
HincII GTYRAC 2 cut(s) 81, 342
HindII GTYRAC 2 cut(s) 81, 342
HinfI GANTC 2 cut(s) 14, 275
Hpy166II GTNNAC 2 cut(s) 81, 342
Hpy188I TCNGA 3 cut(s) 13, 261, 274
Hpy8I GTNNAC 2 cut(s) 81, 342
HpyAV CCTTC 3 cut(s) 82, 254, 343
HpyCH4V TGCA 3 cut(s) 138, 235, 399
HpyF3I CTNAG 4 cut(s) 30, 150, 258, 411
Hsp92II CATG 3 cut(s) 64, 235, 325
Kzo9I GATC 1 cut(s) 473
LguI GCTCTTC 1 cut(s) 259
Lsp1109I GCAGC 2 cut(s) 122, 383
MaeIII GTNAC 2 cut(s) 49, 310
MalI GATC 1 cut(s) 475
MboI GATC 1 cut(s) 473
MboII GAAGA 3 cut(s) 180, 246, 441
MflI RGATCY 1 cut(s) 473
MhlI GDGCHC 1 cut(s) 224
MluCI AATT 6 cut(s) 140, 154, 171, 401, 415, 432
MnlI CCTC 6 cut(s) 19, 59, 69, 280, 320, 330
MroXI GAANNNNTTC 2 cut(s) 38, 299
MspA1I CMGCKG 1 cut(s) 29
NdeII GATC 1 cut(s) 473
NlaIII CATG 3 cut(s) 64, 235, 325
NmeAIII GCCGAG 1 cut(s) 316
NmuCI GTSAC 2 cut(s) 49, 310
PciSI GCTCTTC 1 cut(s) 259
PdmI GAANNNNTTC 2 cut(s) 38, 299
PfeI GAWTC 2 cut(s) 14, 275
PkrI GCNGC 3 cut(s) 137, 398, 495
PsuI RGATCY 1 cut(s) 473
PvuII CAGCTG 1 cut(s) 29
SapI GCTCTTC 1 cut(s) 259
SatI GCNGC 3 cut(s) 136, 397, 494
Sau3AI GATC 1 cut(s) 473
SduI GDGCHC 1 cut(s) 224
SfcI CTRYAG 3 cut(s) 192, 453, 477
Sse9I AATT 6 cut(s) 140, 154, 171, 401, 415, 432
TaqI TCGA 2 cut(s) 214, 463
TasI AATT 6 cut(s) 140, 154, 171, 401, 415, 432
TfiI GAWTC 2 cut(s) 14, 275
TscAI CASTG 1 cut(s) 254
TseFI GTSAC 2 cut(s) 49, 310
TseI GCWGC 3 cut(s) 135, 396, 493
Tsp45I GTSAC 2 cut(s) 49, 310
TspDTI ATGAA 1 cut(s) 220
TspRI CASTG 1 cut(s) 254
XapI RAATTY 4 cut(s) 154, 171, 415, 432
XmnI GAANNNNTTC 2 cut(s) 38, 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.