pycom03g01510

X-Pro dipeptidyl-peptidase (S15 family)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Forward (+)
1138273 .. 1138491
219 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g01510.1

Sequence Viewer

Length: 219 bp
ATGAGAGGGGTTGGGAGGTCAACAAGGAGGGCCTCTCTCACTGGGTTTGCAGAAATTAAGGATGTGATTGCTGTCTGCAAATGGGTTTCTGAGAATCTATCAGCTGACAGGATTTTGTTGGTGGTTTCTTCTGCAGGTATAATATTTTTGAATTTTTATGCTCTTTTAGAATATGTTTCTGCAATTTTTATTGGATTAAGCATGCTGGTTATAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

73

Amino Acids

7.88

Weight (kDa)

9.1

Isoelectric Point (pI)

30.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017736)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 212
Acc36I ACCTGC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 151
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 30
ApoI RAATTY 1 cut(s) 151
AspS9I GGNCC 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 132
BfuAI ACCTGC 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 30
BmrI ACTGGG 1 cut(s) 51
BmuI ACTGGG 1 cut(s) 51
BplI GAGNNNNNCTC 2 cut(s) 19, 51
Bse1I ACTGG 1 cut(s) 46
BseGI GGATG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 46
BshFI GGCC 1 cut(s) 32
BsnI GGCC 1 cut(s) 32
BspANI GGCC 1 cut(s) 32
BspCNI CTCAG 1 cut(s) 82
BspMAI CTGCAG 1 cut(s) 136
BspMI ACCTGC 1 cut(s) 125
BsrI ACTGG 1 cut(s) 46
BstC8I GCNNGC 1 cut(s) 203
BstDEI CTNAG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 67
BstNSI RCATGY 1 cut(s) 205
BstSFI CTRYAG 1 cut(s) 132
BsuRI GGCC 1 cut(s) 32
BtsCI GGATG 1 cut(s) 67
BtsIMutI CAGTG 1 cut(s) 39
BveI ACCTGC 1 cut(s) 125
Cac8I GCNNGC 1 cut(s) 203
Cfr13I GGNCC 1 cut(s) 30
CviAII CATG 1 cut(s) 202
CviJI RGCY 2 cut(s) 32, 104
CviKI_1 RGCY 2 cut(s) 32, 104
DdeI CTNAG 1 cut(s) 90
EcoO109I RGGNCCY 1 cut(s) 30
FaeI CATG 1 cut(s) 205
FaiI YATR 5 cut(s) 140, 159, 174, 203, 212
FatI CATG 1 cut(s) 201
FokI GGATG 1 cut(s) 74
HaeIII GGCC 1 cut(s) 32
Hin1II CATG 1 cut(s) 205
HincII GTYRAC 1 cut(s) 21
HindII GTYRAC 1 cut(s) 21
HinfI GANTC 1 cut(s) 94
Hpy166II GTNNAC 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 21
HpyCH4V TGCA 4 cut(s) 50, 78, 134, 182
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 1 cut(s) 205
LpnPI CCDG 4 cut(s) 27, 94, 120, 191
MboII GAAGA 1 cut(s) 120
MluCI AATT 4 cut(s) 54, 151, 183, 214
MnlI CCTC 3 cut(s) 9, 21, 43
MseI TTAA 3 cut(s) 57, 197, 217
MspA1I CMGCKG 1 cut(s) 104
NlaIII CATG 1 cut(s) 205
NspI RCATGY 1 cut(s) 205
PaeI GCATGC 1 cut(s) 205
PfeI GAWTC 1 cut(s) 94
PsiI TTATAA 1 cut(s) 212
PspPI GGNCC 1 cut(s) 30
PstI CTGCAG 1 cut(s) 136
PvuII CAGCTG 1 cut(s) 104
SaqAI TTAA 3 cut(s) 57, 197, 217
Sau96I GGNCC 1 cut(s) 30
SetI ASST 3 cut(s) 20, 106, 139
SfcI CTRYAG 1 cut(s) 132
SgeI CNNG 5 cut(s) 36, 54, 121, 147, 214
SphI GCATGC 1 cut(s) 205
Sse9I AATT 4 cut(s) 54, 151, 183, 214
SspI AATATT 1 cut(s) 144
TasI AATT 4 cut(s) 54, 151, 183, 214
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 3 cut(s) 57, 197, 217
Tru9I TTAA 3 cut(s) 57, 197, 217
TscAI CASTG 1 cut(s) 46
TspRI CASTG 1 cut(s) 46
XapI RAATTY 1 cut(s) 151
XceI RCATGY 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.