MD03G1086900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0014134
Physical Location & Seq
Forward (+)
7087965 .. 7089256
1292 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1086900.v1.1.491

Sequence Viewer

Length: 528 bp
ATGGCTACCACATCCATATCTCTATCCCCACCACCACCAACTTCCTCCCATTTTCTCAAGCCAAGCCATTCCCAATTCCTCAGAACAACCCTGAAACCATCCTTCCATTTATCCTCCCCAATAACGACAACCAAACGGACCTTAACTTTCATCACCCCAAATGATAATCTCAACCACAGAAGCACCCCAACTTGGCAAATCAGCGCCACCGCCTCTGCTGAATCCGTGCCTGCAGAAGCCTCCGTGCCACTTGAGACTGCGCAGGAGATAGTGGCCTCTAGTGACGAAGGAGTGTCTGTCGCAATTTCTGTTCTTCTTTTCGTCGCCTTTGTTGGTCTCTCCATCCTCACCATTGGGGTGATATACCTAGGTGTGACAGATTATCTGCAGAAGAGGGAGAGAGAGAAGCTTGAGAAAGATGAGGAAACTAACAAGAAGAAGAGTGGGAAGAAGAAGAGGGTGAGAGCAAGAGCTGGCCCTAAGGGATTCGGCCAAAAGATTACTATCGATGAAGAAGATGATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

176

Amino Acids

19.11

Weight (kDa)

8.83

Isoelectric Point (pI)

43.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014134)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G29180
fragaria_vesca FvH4_3g36880
malus_domestica MD03G1086900.v1.1 MD11G1096000.v1.1
prunus_persica Prupe.6G071500_v2.0.a1
pyrus_communis pycom03g06880 pycom11g08130
rosa_chinensis RchiOBHm_Chr5g0066101
rosa_laevigata RLG00000035842
rosa_multiflora Rmu_sc0002406.1_g000008
rosa_roxburghii Rroxscaffold_1G00014910
rosa_rugosa Rorug05G0376300
rosa_samantha Rh5AG434800 Rh5BG451100 Rh5CG473400 Rh5DG464700
rosa_wichuraiana Rw5G040720

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 261
AciI CCGC 1 cut(s) 210
AcoI YGGCCR 1 cut(s) 490
AfiI CCNNNNNNNGG 1 cut(s) 192
AluBI AGCT 2 cut(s) 409, 473
AluI AGCT 2 cut(s) 409, 473
Alw26I GTCTC 2 cut(s) 248, 341
AoxI GGCC 3 cut(s) 273, 475, 490
AspA2I CCTAGG 1 cut(s) 367
AspLEI GCGC 2 cut(s) 206, 262
AspS9I GGNCC 2 cut(s) 138, 476
AsuHPI GGTGA 4 cut(s) 145, 340, 370, 472
AvaII GGWCC 1 cut(s) 138
AvrII CCTAGG 1 cut(s) 367
AxyI CCTNAGG 1 cut(s) 480
BccI CCATC 2 cut(s) 106, 350
BcoDI GTCTC 2 cut(s) 248, 341
BfaI CTAG 2 cut(s) 279, 368
BfmI CTRYAG 2 cut(s) 231, 386
BfoI RGCGCY 1 cut(s) 207
BlnI CCTAGG 1 cut(s) 367
Bme18I GGWCC 1 cut(s) 138
BmgT120I GGNCC 2 cut(s) 138, 476
BpuEI CTTGAG 3 cut(s) 41, 272, 431
Bsa29I ATCGAT 1 cut(s) 507
BsaBI GATNNNNATC 1 cut(s) 503
BsaI GGTCTC 1 cut(s) 341
BsaJI CCNNGG 1 cut(s) 367
BsaXI ACNNNNNCTCC 2 cut(s) 282, 312
Bsc4I CCNNNNNNNGG 1 cut(s) 192
Bse21I CCTNAGG 1 cut(s) 480
Bse8I GATNNNNATC 1 cut(s) 503
BseCI ATCGAT 1 cut(s) 507
BseDI CCNNGG 1 cut(s) 367
BseGI GGATG 3 cut(s) 11, 98, 342
BseJI GATNNNNATC 1 cut(s) 503
BseLI CCNNNNNNNGG 1 cut(s) 192
BseMII CTCAG 1 cut(s) 94
BshFI GGCC 3 cut(s) 275, 477, 492
BshVI ATCGAT 1 cut(s) 507
BslI CCNNNNNNNGG 1 cut(s) 192
BsmAI GTCTC 2 cut(s) 248, 341
BsnI GGCC 3 cut(s) 275, 477, 492
Bso31I GGTCTC 1 cut(s) 341
BspACI CCGC 1 cut(s) 210
BspANI GGCC 3 cut(s) 275, 477, 492
BspCNI CTCAG 1 cut(s) 93
BspDI ATCGAT 1 cut(s) 507
BspMAI CTGCAG 2 cut(s) 235, 390
BspTNI GGTCTC 1 cut(s) 341
BssECI CCNNGG 1 cut(s) 367
BssT1I CCWWGG 1 cut(s) 367
Bst6I CTCTTC 3 cut(s) 386, 434, 449
BstC8I GCNNGC 2 cut(s) 231, 475
BstDEI CTNAG 2 cut(s) 80, 480
BstF5I GGATG 3 cut(s) 11, 98, 342
BstH2I RGCGCY 1 cut(s) 207
BstHHI GCGC 2 cut(s) 206, 262
BstMAI GTCTC 2 cut(s) 248, 341
BstSFI CTRYAG 2 cut(s) 231, 386
Bsu15I ATCGAT 1 cut(s) 507
Bsu36I CCTNAGG 1 cut(s) 480
BsuRI GGCC 3 cut(s) 275, 477, 492
BsuTUI ATCGAT 1 cut(s) 507
BtsCI GGATG 3 cut(s) 11, 98, 342
Cac8I GCNNGC 2 cut(s) 231, 475
CfoI GCGC 2 cut(s) 206, 262
Cfr13I GGNCC 2 cut(s) 138, 476
ClaI ATCGAT 1 cut(s) 507
CviJI RGCY 9 cut(s) 5, 61, 66, 239, 275, 409, 473, 477, 492
CviKI_1 RGCY 9 cut(s) 5, 61, 66, 239, 275, 409, 473, 477, 492
DdeI CTNAG 2 cut(s) 80, 480
EaeI YGGCCR 1 cut(s) 490
Eam1104I CTCTTC 3 cut(s) 386, 434, 449
EarI CTCTTC 3 cut(s) 386, 434, 449
Eco130I CCWWGG 1 cut(s) 367
Eco31I GGTCTC 1 cut(s) 341
Eco47I GGWCC 1 cut(s) 138
Eco81I CCTNAGG 1 cut(s) 480
EcoT14I CCWWGG 1 cut(s) 367
ErhI CCWWGG 1 cut(s) 367
FaiI YATR 2 cut(s) 17, 364
FokI GGATG 2 cut(s) 85, 329
FspBI CTAG 2 cut(s) 279, 368
FspI TGCGCA 1 cut(s) 261
GlaI GCGC 2 cut(s) 205, 261
HaeII RGCGCY 1 cut(s) 207
HaeIII GGCC 3 cut(s) 275, 477, 492
HhaI GCGC 2 cut(s) 206, 262
Hin6I GCGC 2 cut(s) 204, 260
HinP1I GCGC 2 cut(s) 204, 260
HindIII AAGCTT 1 cut(s) 407
HinfI GANTC 2 cut(s) 221, 486
HphI GGTGA 4 cut(s) 145, 340, 370, 472
Hpy188I TCNGA 1 cut(s) 83
Hpy99I CGWCG 1 cut(s) 326
HpyAV CCTTC 2 cut(s) 112, 281
HpyCH4V TGCA 2 cut(s) 233, 388
HpyF3I CTNAG 2 cut(s) 80, 480
HspAI GCGC 2 cut(s) 204, 260
LpnPI CCDG 4 cut(s) 104, 243, 248, 459
MaeI CTAG 2 cut(s) 279, 368
MaeIII GTNAC 2 cut(s) 281, 373
MboII GAAGA 9 cut(s) 305, 403, 448, 451, 460, 463, 466, 524, 527
MluCI AATT 2 cut(s) 74, 303
MseI TTAA 1 cut(s) 143
MslI CAYNNNNRTG 1 cut(s) 356
NmuCI GTSAC 2 cut(s) 281, 373
NsbI TGCGCA 1 cut(s) 261
PfeI GAWTC 2 cut(s) 221, 486
PspPI GGNCC 2 cut(s) 138, 476
PstI CTGCAG 2 cut(s) 235, 390
RseI CAYNNNNRTG 1 cut(s) 356
SaqAI TTAA 1 cut(s) 143
Sau96I GGNCC 2 cut(s) 138, 476
SetI ASST 5 cut(s) 143, 369, 373, 411, 475
SfcI CTRYAG 2 cut(s) 231, 386
SinI GGWCC 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 356
SmlI CTYRAG 3 cut(s) 56, 251, 410
SmoI CTYRAG 3 cut(s) 56, 251, 410
Sse9I AATT 2 cut(s) 74, 303
SsiI CCGC 1 cut(s) 210
SspMI CTAG 2 cut(s) 279, 368
StyI CCWWGG 1 cut(s) 367
TaqI TCGA 1 cut(s) 507
TasI AATT 2 cut(s) 74, 303
TfiI GAWTC 2 cut(s) 221, 486
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TseFI GTSAC 2 cut(s) 281, 373
Tsp45I GTSAC 2 cut(s) 281, 373
TspDTI ATGAA 2 cut(s) 139, 525
TspGWI ACGGA 3 cut(s) 151, 214, 232
VpaK11BI GGWCC 1 cut(s) 138
XmaJI CCTAGG 1 cut(s) 367
XspI CTAG 2 cut(s) 279, 368
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.