Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002406.1

Orthogroup ID

OG0014134

Physical Location & Seq

Genomic Coordinates Reverse (-)

38626 .. 40135

Gene Structure 1510 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002406.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 567 bp

atgtctgaacgtacggtgcagaagggaggagacaatgttgagaaaaatatttgcggtgatgtgacgtgtcacataccacaccacatgtccacatgtgtatggcgtatgttcaattgtcgaacccagaaaccaaatgctttgcctttgccctcacaaaccaatttttcaaccaaaaagacctcaactttccacaacccacatgagaatattaaccagagaagcaccctaatttggagaacctatgcaacctcagttgaatctgtggcttcagaagcaaacccaattgagactgcacaggagatagtggccaccactagtgatgatggtgtctctgtcaccatttctgttcttctctttgttgcatttgttggtctcaccattctcactattggggttgtgtacctaggtgtgacagattacttgcagaagagggagagggagaagcttgagaaagaagaggaagctaacaagaagaagggtggaaagaagaggagactgagagcaagagctgggcctaagggatttggacaaaaggttgaagagtttgaatttgatgcagatgattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

188

Amino Acids

21.07

Weight (kDa)

8.32

Isoelectric Point (pI)

49.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014134)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G29180
fragaria_vesca	FvH4_3g36880
malus_domestica	MD03G1086900.v1.1 MD11G1096000.v1.1
prunus_persica	Prupe.6G071500_v2.0.a1
pyrus_communis	pycom03g06880 pycom11g08130
rosa_chinensis	RchiOBHm_Chr5g0066101
rosa_laevigata	RLG00000035842
rosa_multiflora	Rmu_sc0002406.1_g000008
rosa_roxburghii	Rroxscaffold_1G00014910
rosa_rugosa	Rorug05G0376300
rosa_samantha	Rh5AG434800 Rh5BG451100 Rh5CG473400 Rh5DG464700
rosa_wichuraiana	Rw5G040720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	54
AcoI	YGGCCR	1 cut(s)	306
AcsI	RAATTY	1 cut(s)	548
AcuI	CTGAAG	1 cut(s)	252
AfaI	GTAC	2 cut(s)	13, 401
AfiI	CCNNNNNNNGG	1 cut(s)	231
AflIII	ACRYGT	3 cut(s)	65, 84, 92
AgsI	TTSAA	5 cut(s)	112, 168, 257, 539, 548
AhlI	ACTAGT	1 cut(s)	314
AjiI	CACGTC	1 cut(s)	66
AluBI	AGCT	3 cut(s)	445, 464, 509
AluI	AGCT	3 cut(s)	445, 464, 509
Alw26I	GTCTC	5 cut(s)	24, 281, 334, 377, 487
AoxI	GGCC	2 cut(s)	306, 512
ApoI	RAATTY	1 cut(s)	548
AspA2I	CCTAGG	1 cut(s)	403
AspS9I	GGNCC	1 cut(s)	512
AsuHPI	GGTGA	3 cut(s)	68, 328, 367
AvrII	CCTAGG	1 cut(s)	403
AxyI	CCTNAGG	1 cut(s)	516
BalI	TGGCCA	1 cut(s)	308
BccI	CCATC	1 cut(s)	317
BcoDI	GTCTC	5 cut(s)	24, 281, 334, 377, 487
BcuI	ACTAGT	1 cut(s)	314
BfaI	CTAG	2 cut(s)	315, 404
BlnI	CCTAGG	1 cut(s)	403
BmgBI	CACGTC	1 cut(s)	66
BmgT120I	GGNCC	1 cut(s)	512
BmsI	GCATC	1 cut(s)	544
BpuEI	CTTGAG	1 cut(s)	467
BsaI	GGTCTC	1 cut(s)	377
BsaJI	CCNNGG	1 cut(s)	403
BsaXI	ACNNNNNCTCC	2 cut(s)	21, 51
Bsc4I	CCNNNNNNNGG	1 cut(s)	231
Bse21I	CCTNAGG	1 cut(s)	516
BseDI	CCNNGG	1 cut(s)	403
BseLI	CCNNNNNNNGG	1 cut(s)	231
BseMII	CTCAG	2 cut(s)	264, 488
BseRI	GAGGAG	2 cut(s)	42, 505
BseYI	CCCAGC	1 cut(s)	509
BsgI	GTGCAG	2 cut(s)	38, 276
BshFI	GGCC	2 cut(s)	308, 514
BsiWI	CGTACG	1 cut(s)	11
BslI	CCNNNNNNNGG	1 cut(s)	231
BsmAI	GTCTC	5 cut(s)	24, 281, 334, 377, 487
BsnI	GGCC	2 cut(s)	308, 514
Bso31I	GGTCTC	1 cut(s)	377
BspACI	CCGC	1 cut(s)	54
BspANI	GGCC	2 cut(s)	308, 514
BspCNI	CTCAG	2 cut(s)	263, 489
BspTNI	GGTCTC	1 cut(s)	377
BssECI	CCNNGG	1 cut(s)	403
BssT1I	CCWWGG	1 cut(s)	403
Bst4CI	ACNGT	1 cut(s)	16
Bst6I	CTCTTC	4 cut(s)	422, 450, 482, 534
BstDEI	CTNAG	3 cut(s)	250, 497, 516
BstMAI	GTCTC	5 cut(s)	24, 281, 334, 377, 487
BstMWI	GCNNNNNNNGC	1 cut(s)	272
BstNSI	RCATGY	2 cut(s)	88, 96
Bsu36I	CCTNAGG	1 cut(s)	516
BsuRI	GGCC	2 cut(s)	308, 514
BtrI	CACGTC	1 cut(s)	66
Cfr13I	GGNCC	1 cut(s)	512
Csp6I	GTAC	2 cut(s)	12, 400
CviAII	CATG	3 cut(s)	85, 93, 200
CviJI	RGCY	6 cut(s)	266, 308, 445, 464, 509, 514
CviKI_1	RGCY	6 cut(s)	266, 308, 445, 464, 509, 514
CviQI	GTAC	2 cut(s)	12, 400
DdeI	CTNAG	3 cut(s)	250, 497, 516
EaeI	YGGCCR	1 cut(s)	306
Eam1104I	CTCTTC	4 cut(s)	422, 450, 482, 534
EarI	CTCTTC	4 cut(s)	422, 450, 482, 534
Eco130I	CCWWGG	1 cut(s)	403
Eco31I	GGTCTC	1 cut(s)	377
Eco57I	CTGAAG	1 cut(s)	252
Eco81I	CCTNAGG	1 cut(s)	516
EcoT14I	CCWWGG	1 cut(s)	403
ErhI	CCWWGG	1 cut(s)	403
FaeI	CATG	3 cut(s)	88, 96, 203
FaiI	YATR	7 cut(s)	74, 86, 94, 100, 107, 201, 243
FatI	CATG	3 cut(s)	84, 92, 199
FspBI	CTAG	2 cut(s)	315, 404
GsaI	CCCAGC	1 cut(s)	513
HaeIII	GGCC	2 cut(s)	308, 514
Hin1II	CATG	3 cut(s)	88, 96, 203
HindIII	AAGCTT	1 cut(s)	443
HinfI	GANTC	1 cut(s)	257
HphI	GGTGA	3 cut(s)	68, 328, 367
Hpy166II	GTNNAC	2 cut(s)	90, 400
Hpy188I	TCNGA	2 cut(s)	7, 271
Hpy8I	GTNNAC	2 cut(s)	90, 400
HpyAV	CCTTC	2 cut(s)	16, 469
HpyCH4III	ACNGT	1 cut(s)	16
HpyCH4IV	ACGT	2 cut(s)	10, 65
HpyCH4V	TGCA	6 cut(s)	19, 245, 293, 362, 424, 557
HpyF10VI	GCNNNNNNNGC	1 cut(s)	272
HpyF3I	CTNAG	3 cut(s)	250, 497, 516
HpySE526I	ACGT	2 cut(s)	10, 65
Hsp92II	CATG	3 cut(s)	88, 96, 203
LpnPI	CCDG	4 cut(s)	137, 227, 281, 495
LweI	GCATC	1 cut(s)	544
MaeI	CTAG	2 cut(s)	315, 404
MaeII	ACGT	2 cut(s)	10, 65
MaeIII	GTNAC	4 cut(s)	61, 68, 334, 409
MboII	GAAGA	6 cut(s)	341, 439, 467, 484, 499, 551
MfeI	CAATTG	2 cut(s)	112, 282
MlsI	TGGCCA	1 cut(s)	308
MluCI	AATT	5 cut(s)	112, 160, 228, 282, 548
MluNI	TGGCCA	1 cut(s)	308
MnlI	CCTC	8 cut(s)	20, 160, 190, 259, 423, 429, 451, 483
Mox20I	TGGCCA	1 cut(s)	308
MscI	TGGCCA	1 cut(s)	308
MseI	TTAA	2 cut(s)	210, 565
MslI	CAYNNNNRTG	1 cut(s)	97
Msp20I	TGGCCA	1 cut(s)	308
MunI	CAATTG	2 cut(s)	112, 282
MwoI	GCNNNNNNNGC	1 cut(s)	272
NlaIII	CATG	3 cut(s)	88, 96, 203
NmuCI	GTSAC	4 cut(s)	61, 68, 334, 409
NspI	RCATGY	2 cut(s)	88, 96
PciI	ACATGT	2 cut(s)	84, 92
PfeI	GAWTC	1 cut(s)	257
Pfl23II	CGTACG	1 cut(s)	11
PscI	ACATGT	2 cut(s)	84, 92
PspFI	CCCAGC	1 cut(s)	509
PspLI	CGTACG	1 cut(s)	11
PspPI	GGNCC	1 cut(s)	512
RsaI	GTAC	2 cut(s)	13, 401
RsaNI	GTAC	2 cut(s)	12, 400
RseI	CAYNNNNRTG	1 cut(s)	97
SaqAI	TTAA	2 cut(s)	210, 565
Sau96I	GGNCC	1 cut(s)	512
SfaNI	GCATC	1 cut(s)	544
SmiMI	CAYNNNNRTG	1 cut(s)	97
SmlI	CTYRAG	1 cut(s)	446
SmoI	CTYRAG	1 cut(s)	446
SpeI	ACTAGT	1 cut(s)	314
Sse9I	AATT	5 cut(s)	112, 160, 228, 282, 548
SsiI	CCGC	1 cut(s)	54
SspI	AATATT	2 cut(s)	49, 208
SspMI	CTAG	2 cut(s)	315, 404
StyI	CCWWGG	1 cut(s)	403
TaaI	ACNGT	1 cut(s)	16
TaiI	ACGT	2 cut(s)	13, 68
TaqI	TCGA	1 cut(s)	118
TasI	AATT	5 cut(s)	112, 160, 228, 282, 548
TfiI	GAWTC	1 cut(s)	257
Tru1I	TTAA	2 cut(s)	210, 565
Tru9I	TTAA	2 cut(s)	210, 565
TseFI	GTSAC	4 cut(s)	61, 68, 334, 409
Tsp45I	GTSAC	4 cut(s)	61, 68, 334, 409
XapI	RAATTY	1 cut(s)	548
XceI	RCATGY	2 cut(s)	88, 96
XmaJI	CCTAGG	1 cut(s)	403
XspI	CTAG	2 cut(s)	315, 404

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.