Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr03

Orthogroup ID

OG0019268

Physical Location & Seq

Genomic Coordinates Reverse (-)

23319932 .. 23320090

Gene Structure 159 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD03G1171600.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 159 bp

ATGAAGCTCCAGATTAAGGTCGATGATAGCACGAGAAAGATTGATGATGCTTGCTTCAAGACCTTTGGGTGTGGATCGGCCATTGCTTCTTCTTCTGTCTCTACGGAATGGGTGAAGGGGAAACAAATGGAGGAAGTCTTTACGATTAAGAACACATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005198 GO:0005488 GO:0005506 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005759 GO:0006807 GO:0006873 GO:0006875 GO:0006879 GO:0008150 GO:0008152 GO:0008198 GO:0009987 GO:0010467 GO:0016740 GO:0016782 GO:0019538 GO:0019725 GO:0030003 GO:0031974 GO:0036455 GO:0042592 GO:0043167 GO:0043169 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044238 GO:0044422 GO:0044424 GO:0044429 GO:0044444 GO:0044446 GO:0044464 GO:0046872 GO:0046914 GO:0046916 GO:0048037 GO:0048878 GO:0050801 GO:0051536 GO:0051537 GO:0051539 GO:0051540 GO:0051604 GO:0055065 GO:0055072 GO:0055076 GO:0055080 GO:0055082 GO:0065007 GO:0065008 GO:0070013 GO:0071704 GO:0097428 GO:0098771 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NifU_N

Protein Analysis

53

Amino Acids

5.76

Weight (kDa)

7.76

Isoelectric Point (pI)

28.61

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
NifU_N	PF01592	1 - 52	6.4e-20	NifU-like N terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019268)

Species	Orthologous Gene IDs
malus_domestica	MD03G1171600.v1.1 MD13G1211600.v1.1 MD13G1211700.v1.1 MD14G1077900.v1.1
rosa_multiflora	Rmu_sc0002363.1_g000001
rosa_roxburghii	Rroxscaffold_4G00322320 Rroxscaffold_6G00390330
rosa_samantha	Rh3DG317400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	82
AcoI	YGGCCR	1 cut(s)	78
AfiI	CCNNNNNNNGG	1 cut(s)	16
AgsI	TTSAA	1 cut(s)	58
AluBI	AGCT	1 cut(s)	7
AluI	AGCT	1 cut(s)	7
Alw26I	GTCTC	1 cut(s)	103
AlwI	GGATC	1 cut(s)	82
AoxI	GGCC	1 cut(s)	78
AsuHPI	GGTGA	1 cut(s)	124
BauI	CACGAG	1 cut(s)	31
BcoDI	GTCTC	1 cut(s)	103
BmsI	GCATC	1 cut(s)	37
Bsc4I	CCNNNNNNNGG	1 cut(s)	16
Bse3DI	GCAATG	1 cut(s)	81
BseLI	CCNNNNNNNGG	1 cut(s)	16
BseMI	GCAATG	1 cut(s)	81
BshFI	GGCC	1 cut(s)	80
BslI	CCNNNNNNNGG	1 cut(s)	16
BsmAI	GTCTC	1 cut(s)	103
BsnI	GGCC	1 cut(s)	80
Bsp143I	GATC	1 cut(s)	74
BspANI	GGCC	1 cut(s)	80
BspPI	GGATC	1 cut(s)	82
BsrDI	GCAATG	1 cut(s)	81
BssMI	GATC	1 cut(s)	74
BssSI	CACGAG	1 cut(s)	31
Bst2BI	CACGAG	1 cut(s)	31
BstC8I	GCNNGC	1 cut(s)	52
BstKTI	GATC	1 cut(s)	77
BstMAI	GTCTC	1 cut(s)	103
BstMBI	GATC	1 cut(s)	74
BsuRI	GGCC	1 cut(s)	80
Cac8I	GCNNGC	1 cut(s)	52
CviJI	RGCY	2 cut(s)	7, 80
CviKI_1	RGCY	2 cut(s)	7, 80
DpnI	GATC	1 cut(s)	76
DpnII	GATC	1 cut(s)	74
EaeI	YGGCCR	1 cut(s)	78
FaiI	YATR	1 cut(s)	157
HaeIII	GGCC	1 cut(s)	80
HphI	GGTGA	1 cut(s)	124
Hpy188III	TCNNGA	2 cut(s)	10, 58
HpyAV	CCTTC	1 cut(s)	109
Kzo9I	GATC	1 cut(s)	74
LmnI	GCTCC	1 cut(s)	12
LpnPI	CCDG	1 cut(s)	23
LweI	GCATC	1 cut(s)	37
MalI	GATC	1 cut(s)	76
MboI	GATC	1 cut(s)	74
MboII	GAAGA	2 cut(s)	81, 84
MnlI	CCTC	1 cut(s)	124
MseI	TTAA	2 cut(s)	15, 147
NdeII	GATC	1 cut(s)	74
SaqAI	TTAA	2 cut(s)	15, 147
Sau3AI	GATC	1 cut(s)	74
SetI	ASST	3 cut(s)	9, 21, 65
SfaNI	GCATC	1 cut(s)	37
SgeI	CNNG	5 cut(s)	22, 43, 45, 63, 70
TaqI	TCGA	1 cut(s)	21
Tru1I	TTAA	2 cut(s)	15, 147
Tru9I	TTAA	2 cut(s)	15, 147
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	119

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.