MD05G1266500.v1.1

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0020352
Physical Location & Seq
Forward (+)
40137557 .. 40137961
405 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1266500.v1.1.491

Sequence Viewer

Length: 405 bp
ATGAGTGAGATATCGGCGTCGGCAACTCCATATCCTCATAGAGCTGGGAATCTCTGGATGGTTCAGTATGCAACAAACTGGAACATACAAGGGCCTGAGGCATCAGATCATTATATTGATCTGACAAGAAAACTCTACATGTACTTGACTCCTTTTGTTTCCAAGAATCCAAGGAAATCCTTTTACAGCTACAAGGATCTTGACATTGGGATCAACCATAATGCTAATGGCATTGCAAGCTATTTGGAGGGGAGAGTTTTTGGCATTAAGTACTTCAAGCATAACTTTGATAGGTTGGTGAATGTGAAGACCAAGGTCGATCCTGGTAATTTCTTTAGAGCAATTCCACCCATGGAGCCCTTCCCCCTGGCAATCCACTATTCAATCCACCCTATTAAACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BBE FAD_binding_4

Protein Analysis

135

Amino Acids

15.51

Weight (kDa)

9.42

Isoelectric Point (pI)

40.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BBE PF08031 61 - 114 5.1e-13 Berberine and berberine like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020352)

Species Orthologous Gene IDs
malus_domestica MD04G1021800.v1.1 MD05G1266500.v1.1 MD10G1244100.v1.1
rosa_chinensis RchiOBHm_Chr5g0017941
rosa_multiflora Rmu_sc0003834.1_g000006
rosa_rugosa Rorug05G0038900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 204, 218, 314
AcyI GRCGYC 1 cut(s) 17
AfaI GTAC 2 cut(s) 143, 272
AflIII ACRYGT 1 cut(s) 138
AgsI TTSAA 2 cut(s) 277, 384
AjnI CCWGG 2 cut(s) 322, 366
AluBI AGCT 3 cut(s) 44, 189, 240
AluI AGCT 3 cut(s) 44, 189, 240
AlwI GGATC 3 cut(s) 204, 218, 314
AoxI GGCC 1 cut(s) 92
AspS9I GGNCC 1 cut(s) 92
AsuHPI GGTGA 1 cut(s) 310
AxyI CCTNAGG 1 cut(s) 96
BanII GRGCYC 1 cut(s) 360
BbsI GAAGAC 1 cut(s) 314
BccI CCATC 1 cut(s) 52
BciT130I CCWGG 2 cut(s) 324, 368
BmcAI AGTACT 1 cut(s) 272
Bme1390I CCNGG 2 cut(s) 324, 368
BmgT120I GGNCC 1 cut(s) 92
BmiI GGNNCC 1 cut(s) 357
BmrFI CCNGG 2 cut(s) 324, 368
BmsI GCATC 1 cut(s) 110
BoxI GACNNNNGTC 1 cut(s) 314
BpiI GAAGAC 1 cut(s) 314
BsaHI GRCGYC 1 cut(s) 17
BsaJI CCNNGG 4 cut(s) 170, 312, 351, 366
Bse1I ACTGG 1 cut(s) 83
Bse21I CCTNAGG 1 cut(s) 96
Bse3DI GCAATG 1 cut(s) 231
BseBI CCWGG 2 cut(s) 324, 368
BseDI CCNNGG 4 cut(s) 170, 312, 351, 366
BseGI GGATG 1 cut(s) 63
BseMI GCAATG 1 cut(s) 231
BseMII CTCAG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 83
BseYI CCCAGC 1 cut(s) 44
BshFI GGCC 1 cut(s) 94
BsnI GGCC 1 cut(s) 94
Bsp1286I GDGCHC 1 cut(s) 360
Bsp143I GATC 5 cut(s) 106, 118, 196, 210, 319
Bsp19I CCATGG 1 cut(s) 351
BspANI GGCC 1 cut(s) 94
BspCNI CTCAG 1 cut(s) 88
BspLI GGNNCC 1 cut(s) 357
BspPI GGATC 3 cut(s) 204, 218, 314
BsrDI GCAATG 1 cut(s) 231
BsrI ACTGG 1 cut(s) 83
BssECI CCNNGG 4 cut(s) 170, 312, 351, 366
BssMI GATC 5 cut(s) 106, 118, 196, 210, 319
BssNI GRCGYC 1 cut(s) 17
BssT1I CCWWGG 3 cut(s) 170, 312, 351
Bst2UI CCWGG 2 cut(s) 324, 368
Bst4CI ACNGT 1 cut(s) 402
BstACI GRCGYC 1 cut(s) 17
BstC8I GCNNGC 1 cut(s) 238
BstDEI CTNAG 1 cut(s) 96
BstDSI CCRYGG 1 cut(s) 351
BstF5I GGATG 1 cut(s) 63
BstKTI GATC 5 cut(s) 109, 121, 199, 213, 322
BstMBI GATC 5 cut(s) 106, 118, 196, 210, 319
BstMWI GCNNNNNNNGC 1 cut(s) 237
BstNI CCWGG 2 cut(s) 324, 368
BstNSI RCATGY 1 cut(s) 142
BstPAI GACNNNNGTC 1 cut(s) 314
BstSCI CCNGG 2 cut(s) 322, 366
BstV2I GAAGAC 1 cut(s) 314
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
Bsu36I CCTNAGG 1 cut(s) 96
BsuRI GGCC 1 cut(s) 94
BtgI CCRYGG 1 cut(s) 351
BtsCI GGATG 1 cut(s) 63
Cac8I GCNNGC 1 cut(s) 238
Cfr13I GGNCC 1 cut(s) 92
CseI GACGC 1 cut(s) 6
Csp6I GTAC 2 cut(s) 142, 271
CviAII CATG 2 cut(s) 139, 352
CviJI RGCY 5 cut(s) 44, 94, 189, 240, 358
CviKI_1 RGCY 5 cut(s) 44, 94, 189, 240, 358
CviQI GTAC 2 cut(s) 142, 271
DdeI CTNAG 1 cut(s) 96
DpnI GATC 5 cut(s) 108, 120, 198, 212, 321
DpnII GATC 5 cut(s) 106, 118, 196, 210, 319
Eco130I CCWWGG 3 cut(s) 170, 312, 351
Eco24I GRGCYC 1 cut(s) 360
Eco32I GATATC 1 cut(s) 12
Eco81I CCTNAGG 1 cut(s) 96
EcoO109I RGGNCCY 1 cut(s) 92
EcoRII CCWGG 2 cut(s) 322, 366
EcoRV GATATC 1 cut(s) 12
EcoT14I CCWWGG 3 cut(s) 170, 312, 351
EcoT38I GRGCYC 1 cut(s) 360
ErhI CCWWGG 3 cut(s) 170, 312, 351
FaeI CATG 2 cut(s) 142, 355
FaiI YATR 9 cut(s) 31, 39, 69, 86, 114, 140, 219, 282, 353
FalI AAGNNNNNCTT 2 cut(s) 269, 301
FatI CATG 2 cut(s) 138, 351
FokI GGATG 1 cut(s) 70
FriOI GRGCYC 1 cut(s) 360
GsaI CCCAGC 1 cut(s) 48
HaeIII GGCC 1 cut(s) 94
HgaI GACGC 1 cut(s) 6
Hin1I GRCGYC 1 cut(s) 17
Hin1II CATG 2 cut(s) 142, 355
HinfI GANTC 3 cut(s) 49, 148, 166
HphI GGTGA 1 cut(s) 310
Hpy188I TCNGA 2 cut(s) 106, 123
Hpy188III TCNNGA 2 cut(s) 55, 200
Hpy99I CGWCG 1 cut(s) 22
HpyAV CCTTC 1 cut(s) 370
HpyCH4III ACNGT 1 cut(s) 402
HpyCH4V TGCA 2 cut(s) 71, 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 237
HpyF3I CTNAG 1 cut(s) 96
Hsp92I GRCGYC 1 cut(s) 17
Hsp92II CATG 2 cut(s) 142, 355
Kzo9I GATC 5 cut(s) 106, 118, 196, 210, 319
LmnI GCTCC 1 cut(s) 355
LpnPI CCDG 8 cut(s) 30, 40, 64, 108, 309, 336, 353, 380
LweI GCATC 1 cut(s) 110
MalI GATC 5 cut(s) 108, 120, 198, 212, 321
MboI GATC 5 cut(s) 106, 118, 196, 210, 319
MboII GAAGA 1 cut(s) 319
MflI RGATCY 1 cut(s) 196
MhlI GDGCHC 1 cut(s) 360
MluCI AATT 2 cut(s) 328, 342
MlyI GAGTC 1 cut(s) 142
MnlI CCTC 3 cut(s) 45, 91, 241
MseI TTAA 2 cut(s) 267, 396
MspR9I CCNGG 2 cut(s) 324, 368
MvaI CCWGG 2 cut(s) 324, 368
MwoI GCNNNNNNNGC 1 cut(s) 237
NcoI CCATGG 1 cut(s) 351
NdeII GATC 5 cut(s) 106, 118, 196, 210, 319
NlaIII CATG 2 cut(s) 142, 355
NlaIV GGNNCC 1 cut(s) 357
NspI RCATGY 1 cut(s) 142
PciI ACATGT 1 cut(s) 138
PfeI GAWTC 2 cut(s) 49, 166
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
PscI ACATGT 1 cut(s) 138
PshAI GACNNNNGTC 1 cut(s) 314
Psp6I CCWGG 2 cut(s) 322, 366
PspFI CCCAGC 1 cut(s) 44
PspGI CCWGG 2 cut(s) 322, 366
PspN4I GGNNCC 1 cut(s) 357
PspPI GGNCC 1 cut(s) 92
PsuI RGATCY 1 cut(s) 196
RsaI GTAC 2 cut(s) 143, 272
RsaNI GTAC 2 cut(s) 142, 271
SaqAI TTAA 2 cut(s) 267, 396
Sau3AI GATC 5 cut(s) 106, 118, 196, 210, 319
Sau96I GGNCC 1 cut(s) 92
ScaI AGTACT 1 cut(s) 272
SchI GAGTC 1 cut(s) 142
ScrFI CCNGG 2 cut(s) 324, 368
SduI GDGCHC 1 cut(s) 360
SetI ASST 5 cut(s) 46, 191, 242, 296, 318
SfaNI GCATC 1 cut(s) 110
Sse9I AATT 2 cut(s) 328, 342
StyD4I CCNGG 2 cut(s) 322, 366
StyI CCWWGG 3 cut(s) 170, 312, 351
TaaI ACNGT 1 cut(s) 402
TaqI TCGA 1 cut(s) 318
TasI AATT 2 cut(s) 328, 342
TatI WGTACW 2 cut(s) 141, 270
TfiI GAWTC 2 cut(s) 49, 166
Tru1I TTAA 2 cut(s) 267, 396
Tru9I TTAA 2 cut(s) 267, 396
XceI RCATGY 1 cut(s) 142
XcmI CCANNNNNNNNNTGG 1 cut(s) 224
ZrmI AGTACT 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.