RchiOBHm_Chr5g0017941

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0020352
Physical Location & Seq
Reverse (-)
12488899 .. 12489636
738 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29817

Sequence Viewer

Length: 378 bp
ATGAGTGAGATTTCTGAGTCGGAAACTCCCTTCCCTCACAGAGCCGGAAACCTGTTCATGATTCAATATTATATGTCGTGGGAGGAAGAAGGGATTGAGGCCACCAACAGGTACCTTAGCATATCTAGAAAATTTTACAAAATAATGACTCCATTTGTATCCAAGAGACCAAGAGAGGCCTTCCAAAACTATAGAGATCTTGACATTGGGGCCAATTTGGATAATTATACAATCTTTAATATTGCTAGAGTCTATGGAAGCAAATACTTTGAAGGTAATTTTGAAAGGTTGGTACATGTGAAGACCGATGTTGATCCCCAAAACTTTTTCAAGCATGAACAAAGTATTCCACCTCTTGCCCAGTATCATTTAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BBE FAD_binding_4

Protein Analysis

125

Amino Acids

14.87

Weight (kDa)

6.07

Isoelectric Point (pI)

47.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BBE PF08031 60 - 117 2.2e-18 Berberine and berberine like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020352)

Species Orthologous Gene IDs
malus_domestica MD04G1021800.v1.1 MD05G1266500.v1.1 MD10G1244100.v1.1
rosa_chinensis RchiOBHm_Chr5g0017941
rosa_multiflora Rmu_sc0003834.1_g000006
rosa_rugosa Rorug05G0038900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 111
AccB1I GGYRCC 1 cut(s) 111
AclWI GGATC 1 cut(s) 308
AcsI RAATTY 1 cut(s) 131
AfaI GTAC 2 cut(s) 113, 294
AfiI CCNNNNNNNGG 1 cut(s) 108
AflIII ACRYGT 1 cut(s) 295
AgsI TTSAA 4 cut(s) 65, 272, 284, 331
Alw26I GTCTC 1 cut(s) 160
AlwI GGATC 1 cut(s) 308
AoxI GGCC 3 cut(s) 99, 177, 210
ApoI RAATTY 1 cut(s) 131
Asp718I GGTACC 1 cut(s) 111
AspS9I GGNCC 1 cut(s) 210
BanI GGYRCC 1 cut(s) 111
BbsI GAAGAC 1 cut(s) 308
BciVI GTATCC 1 cut(s) 169
BcoDI GTCTC 1 cut(s) 160
BfaI CTAG 2 cut(s) 126, 246
BfmI CTRYAG 1 cut(s) 190
BfuI GTATCC 1 cut(s) 169
BglII AGATCT 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 210
BmiI GGNNCC 2 cut(s) 113, 211
BmrI ACTGGG 1 cut(s) 355
BmuI ACTGGG 1 cut(s) 355
BpiI GAAGAC 1 cut(s) 308
Bpu10I CCTNAGC 1 cut(s) 116
BsaBI GATNNNNATC 1 cut(s) 312
BsaI GGTCTC 1 cut(s) 160
Bsc4I CCNNNNNNNGG 1 cut(s) 108
Bse1I ACTGG 1 cut(s) 361
Bse8I GATNNNNATC 1 cut(s) 312
BseJI GATNNNNATC 1 cut(s) 312
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 6
BseNI ACTGG 1 cut(s) 361
BshFI GGCC 3 cut(s) 101, 179, 212
BshNI GGYRCC 1 cut(s) 111
BsiSI CCGG 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 108
BsmAI GTCTC 1 cut(s) 160
BsnI GGCC 3 cut(s) 101, 179, 212
Bso31I GGTCTC 1 cut(s) 160
Bsp143I GATC 2 cut(s) 196, 313
BspANI GGCC 3 cut(s) 101, 179, 212
BspCNI CTCAG 1 cut(s) 7
BspHI TCATGA 1 cut(s) 57
BspLI GGNNCC 2 cut(s) 113, 211
BspPI GGATC 1 cut(s) 308
BspT107I GGYRCC 1 cut(s) 111
BspTNI GGTCTC 1 cut(s) 160
BsrI ACTGG 1 cut(s) 361
BssMI GATC 2 cut(s) 196, 313
BstDEI CTNAG 2 cut(s) 15, 116
BstKTI GATC 2 cut(s) 199, 316
BstMAI GTCTC 1 cut(s) 160
BstMBI GATC 2 cut(s) 196, 313
BstNSI RCATGY 1 cut(s) 299
BstSFI CTRYAG 1 cut(s) 190
BstV2I GAAGAC 1 cut(s) 308
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BsuI GTATCC 1 cut(s) 169
BsuRI GGCC 3 cut(s) 101, 179, 212
CciI TCATGA 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 210
Csp6I GTAC 2 cut(s) 112, 293
CviAII CATG 3 cut(s) 58, 296, 335
CviJI RGCY 4 cut(s) 44, 101, 179, 212
CviKI_1 RGCY 4 cut(s) 44, 101, 179, 212
CviQI GTAC 2 cut(s) 112, 293
DdeI CTNAG 2 cut(s) 15, 116
DpnI GATC 2 cut(s) 198, 315
DpnII GATC 2 cut(s) 196, 313
Eco147I AGGCCT 1 cut(s) 179
Eco31I GGTCTC 1 cut(s) 160
FaeI CATG 3 cut(s) 61, 299, 338
FaiI YATR 9 cut(s) 59, 72, 74, 122, 192, 228, 255, 297, 336
FatI CATG 3 cut(s) 57, 295, 334
FspBI CTAG 2 cut(s) 126, 246
HaeIII GGCC 3 cut(s) 101, 179, 212
HapII CCGG 1 cut(s) 45
Hin1II CATG 3 cut(s) 61, 299, 338
HinfI GANTC 4 cut(s) 17, 61, 148, 249
HpaII CCGG 1 cut(s) 45
Hpy188I TCNGA 2 cut(s) 16, 22
Hpy188III TCNNGA 3 cut(s) 58, 126, 200
HpyAV CCTTC 4 cut(s) 40, 83, 190, 266
HpyF3I CTNAG 2 cut(s) 15, 116
Hsp92II CATG 3 cut(s) 61, 299, 338
KpnI GGTACC 1 cut(s) 115
Kzo9I GATC 2 cut(s) 196, 313
LpnPI CCDG 4 cut(s) 58, 65, 94, 374
MaeI CTAG 2 cut(s) 126, 246
MalI GATC 2 cut(s) 198, 315
MboI GATC 2 cut(s) 196, 313
MboII GAAGA 2 cut(s) 98, 313
MflI RGATCY 1 cut(s) 196
MluCI AATT 4 cut(s) 131, 214, 223, 277
MlyI GAGTC 3 cut(s) 26, 142, 258
MnlI CCTC 5 cut(s) 45, 76, 91, 169, 363
MseI TTAA 2 cut(s) 237, 376
MspI CCGG 1 cut(s) 45
NdeII GATC 2 cut(s) 196, 313
NlaIII CATG 3 cut(s) 61, 299, 338
NlaIV GGNNCC 2 cut(s) 113, 211
NspI RCATGY 1 cut(s) 299
PagI TCATGA 1 cut(s) 57
PceI AGGCCT 1 cut(s) 179
PciI ACATGT 1 cut(s) 295
PfeI GAWTC 1 cut(s) 61
PleI GAGTC 3 cut(s) 25, 142, 257
PpsI GAGTC 3 cut(s) 25, 142, 257
PscI ACATGT 1 cut(s) 295
PspN4I GGNNCC 2 cut(s) 113, 211
PspPI GGNCC 1 cut(s) 210
PsuI RGATCY 1 cut(s) 196
RsaI GTAC 2 cut(s) 113, 294
RsaNI GTAC 2 cut(s) 112, 293
SaqAI TTAA 2 cut(s) 237, 376
Sau3AI GATC 2 cut(s) 196, 313
Sau96I GGNCC 1 cut(s) 210
SchI GAGTC 3 cut(s) 26, 142, 258
SetI ASST 6 cut(s) 54, 113, 117, 277, 290, 355
SfcI CTRYAG 1 cut(s) 190
Sse9I AATT 4 cut(s) 131, 214, 223, 277
SseBI AGGCCT 1 cut(s) 179
SspI AATATT 2 cut(s) 68, 241
SspMI CTAG 2 cut(s) 126, 246
StuI AGGCCT 1 cut(s) 179
TaqII GACCGA 1 cut(s) 320
TasI AATT 4 cut(s) 131, 214, 223, 277
TfiI GAWTC 1 cut(s) 61
Tru1I TTAA 2 cut(s) 237, 376
Tru9I TTAA 2 cut(s) 237, 376
TspDTI ATGAA 2 cut(s) 46, 351
XapI RAATTY 1 cut(s) 131
XbaI TCTAGA 1 cut(s) 125
XceI RCATGY 1 cut(s) 299
XspI CTAG 2 cut(s) 126, 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.