MD07G1030100.v1.1

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0016380
Physical Location & Seq
Reverse (-)
2517508 .. 2517669
162 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1030100.v1.1.491

Sequence Viewer

Length: 162 bp
ATGGTCTTGAACTTTGCTTTCCTAGACGGTATGTACAATGGTAGTACCGTTAGTATTCGAGGGAGGAATCCATATATGGAAGCCATCCGGCAGATGCCTATCGTTGGAGGTAGTGGAGTTTTTCAATATGCACGGGGCTATGCATTGGCGAAGACATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

54

Amino Acids

5.87

Weight (kDa)

9.82

Isoelectric Point (pI)

34.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 1 - 52 3.9e-18 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016380)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g02300
malus_domestica MD02G1295700.v1.1 MD07G1030100.v1.1
pyrus_communis pycom02g24840
rosa_chinensis RchiOBHm_Chr1g0319651
rosa_laevigata RLG00000030468
rosa_multiflora Rmu_sc0002539.1_g000096
rosa_roxburghii Rroxscaffold_4G00328250
rosa_rugosa Rorug01G0029100
rosa_samantha Rh1AG040800 Rh1BG038000 Rh1CG041900 Rh1DG028000
rosa_wichuraiana Rw0G019980 Rw1G003390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 35, 46
AfiI CCNNNNNNNGG 1 cut(s) 104
AgsI TTSAA 2 cut(s) 10, 125
Asp700I GAANNNNTTC 1 cut(s) 155
BbsI GAAGAC 1 cut(s) 158
BccI CCATC 1 cut(s) 92
BfaI CTAG 2 cut(s) 23, 160
BmsI GCATC 1 cut(s) 84
BpiI GAAGAC 1 cut(s) 158
BsaBI GATNNNNATC 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse8I GATNNNNATC 1 cut(s) 98
BseGI GGATG 1 cut(s) 84
BseJI GATNNNNATC 1 cut(s) 98
BseLI CCNNNNNNNGG 1 cut(s) 104
BsiSI CCGG 1 cut(s) 88
BslI CCNNNNNNNGG 1 cut(s) 104
Bsp1407I TGTACA 1 cut(s) 33
BsrGI TGTACA 1 cut(s) 33
Bst4CI ACNGT 2 cut(s) 29, 49
BstAUI TGTACA 1 cut(s) 33
BstF5I GGATG 1 cut(s) 84
BstV2I GAAGAC 1 cut(s) 158
BtsCI GGATG 1 cut(s) 84
Csp6I GTAC 2 cut(s) 34, 45
CviJI RGCY 2 cut(s) 83, 138
CviKI_1 RGCY 2 cut(s) 83, 138
CviQI GTAC 2 cut(s) 34, 45
EcoT22I ATGCAT 1 cut(s) 145
FaiI YATR 6 cut(s) 32, 73, 75, 77, 129, 141
FokI GGATG 1 cut(s) 71
FspBI CTAG 2 cut(s) 23, 160
HapII CCGG 1 cut(s) 88
HinfI GANTC 1 cut(s) 67
HpaII CCGG 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 7
HpyCH4III ACNGT 2 cut(s) 29, 49
HpyCH4V TGCA 2 cut(s) 131, 143
LpnPI CCDG 1 cut(s) 101
LweI GCATC 1 cut(s) 84
MaeI CTAG 2 cut(s) 23, 160
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 3 cut(s) 53, 57, 101
Mph1103I ATGCAT 1 cut(s) 145
MroXI GAANNNNTTC 1 cut(s) 155
MspI CCGG 1 cut(s) 88
NsiI ATGCAT 1 cut(s) 145
PdmI GAANNNNTTC 1 cut(s) 155
PfeI GAWTC 1 cut(s) 67
RsaI GTAC 2 cut(s) 35, 46
RsaNI GTAC 2 cut(s) 34, 45
SetI ASST 1 cut(s) 112
SfaNI GCATC 1 cut(s) 84
SgeI CNNG 6 cut(s) 19, 35, 71, 100, 144, 146
SspMI CTAG 2 cut(s) 23, 160
TaaI ACNGT 2 cut(s) 29, 49
TaqI TCGA 1 cut(s) 58
TatI WGTACW 1 cut(s) 33
TfiI GAWTC 1 cut(s) 67
XmnI GAANNNNTTC 1 cut(s) 155
XspI CTAG 2 cut(s) 23, 160
Zsp2I ATGCAT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.