MD07G1114100.v1.1

May regulate transcription elongation by RNA polymerase II. May enhance transcriptional pausing at sites proximal to the promoter, which may in turn facilitate the assembly of an elongation competent RNA polymerase II complex

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
13683513 .. 13683731
219 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1114100.v1.1.491

Sequence Viewer

Length: 219 bp
ATGAACGACGACAACGAGTGCGTCATCGATTGCACCACTCCTAATTTCAACGGGATCATTCTAGTAATGGATCCGAGTAGGAGTTGGGCTGTGTGGTGGCTCCGAATTACAAAATTTATCCCTGGTTGTTACATACTCGCTGTTTCAGAGGCTCTTTCGGAGGATATGAAGAATGAGATTCTGCCACAATTCAAGTTTATGAGGAAACAACTGGGTTGA

Protein Analysis

73

Amino Acids

8.35

Weight (kDa)

4.81

Isoelectric Point (pI)

50.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Spt4 PF06093 1 - 48 2.9e-12 Spt4/RpoE2 zinc finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013184)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 62, 65, 78
AcsI RAATTY 1 cut(s) 113
AgsI TTSAA 2 cut(s) 49, 193
AjnI CCWGG 1 cut(s) 121
AlwI GGATC 3 cut(s) 62, 65, 78
ApoI RAATTY 1 cut(s) 113
BamHI GGATCC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 123
BfaI CTAG 1 cut(s) 62
Bme1390I CCNGG 1 cut(s) 123
BmiI GGNNCC 2 cut(s) 72, 101
BmrFI CCNGG 1 cut(s) 123
Bsa29I ATCGAT 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 121
Bse1I ACTGG 1 cut(s) 216
BseBI CCWGG 1 cut(s) 123
BseCI ATCGAT 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 121
BseNI ACTGG 1 cut(s) 216
BshVI ATCGAT 1 cut(s) 27
Bsp143I GATC 2 cut(s) 54, 70
BspDI ATCGAT 1 cut(s) 27
BspLI GGNNCC 2 cut(s) 72, 101
BspPI GGATC 3 cut(s) 62, 65, 78
BsrI ACTGG 1 cut(s) 216
BssECI CCNNGG 1 cut(s) 121
BssMI GATC 2 cut(s) 54, 70
Bst2UI CCWGG 1 cut(s) 123
BstKTI GATC 2 cut(s) 57, 73
BstMBI GATC 2 cut(s) 54, 70
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
Bsu15I ATCGAT 1 cut(s) 27
BsuTUI ATCGAT 1 cut(s) 27
ClaI ATCGAT 1 cut(s) 27
CseI GACGC 1 cut(s) 10
CviJI RGCY 3 cut(s) 89, 100, 152
CviKI_1 RGCY 3 cut(s) 89, 100, 152
DpnI GATC 2 cut(s) 56, 72
DpnII GATC 2 cut(s) 54, 70
EcoRII CCWGG 1 cut(s) 121
FaiI YATR 3 cut(s) 134, 167, 200
FspBI CTAG 1 cut(s) 62
HgaI GACGC 1 cut(s) 10
HinfI GANTC 1 cut(s) 178
Hpy188I TCNGA 4 cut(s) 75, 104, 148, 160
Hpy99I CGWCG 1 cut(s) 11
HpyCH4V TGCA 1 cut(s) 33
Kzo9I GATC 2 cut(s) 54, 70
LmnI GCTCC 1 cut(s) 105
LpnPI CCDG 3 cut(s) 108, 135, 197
MaeI CTAG 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 128
MalI GATC 2 cut(s) 56, 72
MboI GATC 2 cut(s) 54, 70
MboII GAAGA 1 cut(s) 181
MflI RGATCY 1 cut(s) 70
MluCI AATT 4 cut(s) 43, 105, 113, 188
MnlI CCTC 3 cut(s) 142, 154, 195
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
NdeII GATC 2 cut(s) 54, 70
NlaIV GGNNCC 2 cut(s) 72, 101
PcsI WCGNNNNNNNCGW 1 cut(s) 12
PfeI GAWTC 1 cut(s) 178
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PspN4I GGNNCC 2 cut(s) 72, 101
PsuI RGATCY 1 cut(s) 70
Sau3AI GATC 2 cut(s) 54, 70
ScrFI CCNGG 1 cut(s) 123
SgeI CNNG 8 cut(s) 28, 64, 74, 87, 134, 135, 149, 205
Sse9I AATT 4 cut(s) 43, 105, 113, 188
SspMI CTAG 1 cut(s) 62
StyD4I CCNGG 1 cut(s) 121
TaqI TCGA 1 cut(s) 27
TasI AATT 4 cut(s) 43, 105, 113, 188
TfiI GAWTC 1 cut(s) 178
TspDTI ATGAA 2 cut(s) 17, 182
XapI RAATTY 1 cut(s) 113
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.