Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr07

Orthogroup ID

OG0012245

Physical Location & Seq

Genomic Coordinates Reverse (-)

35516977 .. 35517836

Gene Structure 860 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD07G1294000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

ATGGCTTTTAGAATCAATGGGTTTCTTCTTCTACAAGTGCTATACCTCTCAGCACTTCTCATAATTCCCTTATCTTCAGGCATTGTTACTGAAGGCTTCAAGGATGGCATGGATCCCATTAATTTGTTTCACAAGAATGACGTCGAAATCATTTCGAGGAAGCTTCGGAGGCTCCATGCAACAATGCAGGACTACGACGATACAGGATCCAACCCTAGGCACGACCCTAGAAAGAGGACCGGCAATGGCAGGAACCCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

87

Amino Acids

9.78

Weight (kDa)

9.69

Isoelectric Point (pI)

29.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012245)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G53486 AT5G53486 AT5G53486 AT5G53486 AT5G53486
fragaria_vesca	FvH4_7g32040
malus_domestica	MD01G1223300.v1.1 MD07G1294000.v1.1
prunus_persica	Prupe.2G313800_v2.0.a1 Prupe.2G313800_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0381651
rosa_multiflora	Rmu_sc0022590.1_g000001
rosa_roxburghii	Rroxscaffold_4G00278550
rosa_rugosa	Rorug01G0430200
rosa_samantha	Rh1AG453400 Rh1BG410500 Rh1CG425000 Rh1DG442200
rosa_wichuraiana	Rw1G039550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	144
AclWI	GGATC	4 cut(s)	107, 120, 201, 214
AcuI	CTGAAG	2 cut(s)	60, 111
AcyI	GRCGYC	1 cut(s)	141
AfiI	CCNNNNNNNGG	1 cut(s)	216
AgsI	TTSAA	1 cut(s)	100
AluBI	AGCT	1 cut(s)	163
AluI	AGCT	1 cut(s)	163
AlwI	GGATC	4 cut(s)	107, 120, 201, 214
AseI	ATTAAT	1 cut(s)	120
AspA2I	CCTAGG	1 cut(s)	215
AspS9I	GGNCC	1 cut(s)	237
AvaII	GGWCC	1 cut(s)	237
AvrII	CCTAGG	1 cut(s)	215
BamHI	GGATCC	2 cut(s)	112, 206
BccI	CCATC	1 cut(s)	98
BfaI	CTAG	2 cut(s)	216, 228
BlnI	CCTAGG	1 cut(s)	215
Bme18I	GGWCC	1 cut(s)	237
BmgT120I	GGNCC	1 cut(s)	237
BmiI	GGNNCC	4 cut(s)	114, 173, 208, 254
BsaHI	GRCGYC	1 cut(s)	141
BsaJI	CCNNGG	1 cut(s)	215
Bsc4I	CCNNNNNNNGG	1 cut(s)	216
Bse118I	RCCGGY	1 cut(s)	239
Bse3DI	GCAATG	1 cut(s)	250
BseDI	CCNNGG	1 cut(s)	215
BseGI	GGATG	1 cut(s)	109
BseLI	CCNNNNNNNGG	1 cut(s)	216
BseMI	GCAATG	1 cut(s)	250
BseMII	CTCAG	1 cut(s)	63
BsiSI	CCGG	1 cut(s)	240
BslI	CCNNNNNNNGG	1 cut(s)	216
Bsp143I	GATC	2 cut(s)	112, 206
BspCNI	CTCAG	1 cut(s)	62
BspLI	GGNNCC	4 cut(s)	114, 173, 208, 254
BspPI	GGATC	4 cut(s)	107, 120, 201, 214
BsrDI	GCAATG	1 cut(s)	250
BsrFI	RCCGGY	1 cut(s)	239
BssAI	RCCGGY	1 cut(s)	239
BssECI	CCNNGG	1 cut(s)	215
BssMI	GATC	2 cut(s)	112, 206
BssNI	GRCGYC	1 cut(s)	141
BssT1I	CCWWGG	1 cut(s)	215
BstACI	GRCGYC	1 cut(s)	141
BstDEI	CTNAG	1 cut(s)	49
BstF5I	GGATG	1 cut(s)	109
BstKTI	GATC	2 cut(s)	115, 209
BstMBI	GATC	2 cut(s)	112, 206
BstMWI	GCNNNNNNNGC	1 cut(s)	169
BstX2I	RGATCY	2 cut(s)	112, 206
BstYI	RGATCY	2 cut(s)	112, 206
BtsCI	GGATG	1 cut(s)	109
Cfr10I	RCCGGY	1 cut(s)	239
Cfr13I	GGNCC	1 cut(s)	237
CviAII	CATG	3 cut(s)	109, 176, 258
CviJI	RGCY	4 cut(s)	5, 96, 163, 172
CviKI_1	RGCY	4 cut(s)	5, 96, 163, 172
DdeI	CTNAG	1 cut(s)	49
DpnI	GATC	2 cut(s)	114, 208
DpnII	GATC	2 cut(s)	112, 206
Eco130I	CCWWGG	1 cut(s)	215
Eco47I	GGWCC	1 cut(s)	237
Eco57I	CTGAAG	2 cut(s)	60, 111
EcoT14I	CCWWGG	1 cut(s)	215
ErhI	CCWWGG	1 cut(s)	215
FaeI	CATG	3 cut(s)	112, 179, 261
FaiI	YATR	5 cut(s)	43, 62, 110, 177, 259
FatI	CATG	3 cut(s)	108, 175, 257
FokI	GGATG	1 cut(s)	116
FspBI	CTAG	2 cut(s)	216, 228
HapII	CCGG	1 cut(s)	240
Hin1I	GRCGYC	1 cut(s)	141
Hin1II	CATG	3 cut(s)	112, 179, 261
HindIII	AAGCTT	1 cut(s)	161
HinfI	GANTC	1 cut(s)	12
HpaII	CCGG	1 cut(s)	240
Hpy188I	TCNGA	1 cut(s)	168
Hpy99I	CGWCG	2 cut(s)	146, 200
HpyAV	CCTTC	1 cut(s)	86
HpyCH4IV	ACGT	1 cut(s)	141
HpyCH4V	TGCA	2 cut(s)	179, 187
HpyF10VI	GCNNNNNNNGC	1 cut(s)	169
HpyF3I	CTNAG	1 cut(s)	49
HpySE526I	ACGT	1 cut(s)	141
Hsp92I	GRCGYC	1 cut(s)	141
Hsp92II	CATG	3 cut(s)	112, 179, 261
Kzo9I	GATC	2 cut(s)	112, 206
LmnI	GCTCC	1 cut(s)	177
LpnPI	CCDG	5 cut(s)	63, 173, 189, 235, 253
MaeI	CTAG	2 cut(s)	216, 228
MaeII	ACGT	1 cut(s)	141
MaeIII	GTNAC	1 cut(s)	85
MalI	GATC	2 cut(s)	114, 208
MboI	GATC	2 cut(s)	112, 206
MboII	GAAGA	3 cut(s)	17, 20, 66
MflI	RGATCY	2 cut(s)	112, 206
MluCI	AATT	2 cut(s)	63, 121
MmeI	TCCRAC	1 cut(s)	234
MnlI	CCTC	4 cut(s)	56, 150, 162, 228
MseI	TTAA	1 cut(s)	120
MslI	CAYNNNNRTG	1 cut(s)	135
MspI	CCGG	1 cut(s)	240
MwoI	GCNNNNNNNGC	1 cut(s)	169
NdeII	GATC	2 cut(s)	112, 206
NlaIII	CATG	3 cut(s)	112, 179, 261
NlaIV	GGNNCC	4 cut(s)	114, 173, 208, 254
PfeI	GAWTC	1 cut(s)	12
PshBI	ATTAAT	1 cut(s)	120
PspN4I	GGNNCC	4 cut(s)	114, 173, 208, 254
PspPI	GGNCC	1 cut(s)	237
PsuI	RGATCY	2 cut(s)	112, 206
RseI	CAYNNNNRTG	1 cut(s)	135
SaqAI	TTAA	1 cut(s)	120
Sau3AI	GATC	2 cut(s)	112, 206
Sau96I	GGNCC	1 cut(s)	237
SetI	ASST	3 cut(s)	48, 144, 165
SinI	GGWCC	1 cut(s)	237
SmiMI	CAYNNNNRTG	1 cut(s)	135
Sse9I	AATT	2 cut(s)	63, 121
SspMI	CTAG	2 cut(s)	216, 228
StyI	CCWWGG	1 cut(s)	215
TaiI	ACGT	1 cut(s)	144
TaqI	TCGA	2 cut(s)	144, 155
TasI	AATT	2 cut(s)	63, 121
TfiI	GAWTC	1 cut(s)	12
Tru1I	TTAA	1 cut(s)	120
Tru9I	TTAA	1 cut(s)	120
VpaK11BI	GGWCC	1 cut(s)	237
VspI	ATTAAT	1 cut(s)	120
XmaJI	CCTAGG	1 cut(s)	215
XspI	CTAG	2 cut(s)	216, 228
ZraI	GACGTC	1 cut(s)	142

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.