Prupe.2G313800_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
29549090 .. 29550258
1169 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G313800.2

Sequence Viewer

Length: 264 bp
ATGGCTCTTAGAATCAATGTCTTTCTTCTTCTACTACTTTTCCTCTCACTTCTCCTCATTCCCTTATCTTCAGGCATTGTTAATGAAGGGTTCAAGGAGGATGGCATAGACCCCATTCACTTACTTCACAAGGATGGAATCGTAATGAATTCGAGGAAGCTTTGGATGCTTGATGCAACAATGCAGGATTATGATGATACAGGAGCCAATCAAAAACACGACCCTTACCCTAGAAGGAAACCTGGCAATGGAAGGAACCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.87

Weight (kDa)

6.82

Isoelectric Point (pI)

26.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 148
AcuI CTGAAG 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 1 cut(s) 94
AjnI CCWGG 1 cut(s) 241
AluBI AGCT 1 cut(s) 160
AluI AGCT 1 cut(s) 160
ApoI RAATTY 1 cut(s) 148
BccI CCATC 2 cut(s) 95, 128
BciT130I CCWGG 1 cut(s) 243
BfaI CTAG 1 cut(s) 231
Bme1390I CCNGG 1 cut(s) 243
BmiI GGNNCC 2 cut(s) 205, 257
BmrFI CCNGG 1 cut(s) 243
BmsI GCATC 2 cut(s) 156, 163
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse3DI GCAATG 1 cut(s) 253
BseBI CCWGG 1 cut(s) 243
BseGI GGATG 3 cut(s) 106, 139, 171
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMI GCAATG 1 cut(s) 253
BseRI GAGGAG 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 248
BspLI GGNNCC 2 cut(s) 205, 257
BsrDI GCAATG 1 cut(s) 253
Bst2UI CCWGG 1 cut(s) 243
BstDEI CTNAG 1 cut(s) 8
BstF5I GGATG 3 cut(s) 106, 139, 171
BstMWI GCNNNNNNNGC 1 cut(s) 166
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BtsCI GGATG 3 cut(s) 106, 139, 171
CviAII CATG 1 cut(s) 261
CviJI RGCY 3 cut(s) 5, 160, 206
CviKI_1 RGCY 3 cut(s) 5, 160, 206
DdeI CTNAG 1 cut(s) 8
Eco57I CTGAAG 1 cut(s) 54
EcoRI GAATTC 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 241
FaeI CATG 1 cut(s) 264
FaiI YATR 3 cut(s) 107, 192, 262
FatI CATG 1 cut(s) 260
FokI GGATG 3 cut(s) 113, 146, 178
FspBI CTAG 1 cut(s) 231
Hin1II CATG 1 cut(s) 264
HindIII AAGCTT 1 cut(s) 158
HinfI GANTC 2 cut(s) 12, 138
HpyAV CCTTC 3 cut(s) 80, 228, 246
HpyCH4V TGCA 2 cut(s) 176, 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
HpyF3I CTNAG 1 cut(s) 8
Hsp92II CATG 1 cut(s) 264
LmnI GCTCC 1 cut(s) 203
LpnPI CCDG 5 cut(s) 57, 170, 186, 228, 255
LweI GCATC 2 cut(s) 156, 163
MaeI CTAG 1 cut(s) 231
MboII GAAGA 3 cut(s) 17, 20, 60
MluCI AATT 1 cut(s) 148
MnlI CCTC 4 cut(s) 53, 65, 91, 147
MseI TTAA 1 cut(s) 81
MslI CAYNNNNRTG 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
MwoI GCNNNNNNNGC 1 cut(s) 166
NlaIII CATG 1 cut(s) 264
NlaIV GGNNCC 2 cut(s) 205, 257
PfeI GAWTC 2 cut(s) 12, 138
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PspN4I GGNNCC 2 cut(s) 205, 257
RseI CAYNNNNRTG 1 cut(s) 132
SaqAI TTAA 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 243
SetI ASST 2 cut(s) 162, 244
SfaNI GCATC 2 cut(s) 156, 163
SmiMI CAYNNNNRTG 1 cut(s) 132
Sse9I AATT 1 cut(s) 148
SspMI CTAG 1 cut(s) 231
StyD4I CCNGG 1 cut(s) 241
TaqI TCGA 1 cut(s) 152
TasI AATT 1 cut(s) 148
TfiI GAWTC 2 cut(s) 12, 138
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TspDTI ATGAA 2 cut(s) 99, 161
XapI RAATTY 1 cut(s) 148
XspI CTAG 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.