MD11G1079700.v1.1

Thylakoid soluble phosphoprotein TSP9

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
6833052 .. 6833333
282 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1079700.v1.1.491

Sequence Viewer

Length: 282 bp
ATGGCTTCCTTGACAATGGTCTTTCCTCCGGTGGTGACTGGCAGAGCAACCGGCCAAGTGTACGCTGCAACGGAGGCCAAGGGAGGAAGCAAACAAGAGAAGGGTCCGTTTGATTGGATTCTCGGAGGGCTAGCAAAGGAGGACCAGCTGCTGGAGGTTGATCCAATCCTGAAGAAGGTTGAGGACAAGAATGGTTCCGTCAGCGGCGGCAAGGGCACTGTGGCTGTGCCGCCGAAGAAGAAGCAGGGTGGCTTTGGAGGCCTTTTTGCCAAGAAGGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

9.66

Weight (kDa)

9.44

Isoelectric Point (pI)

36.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TSP9 PF11493 24 - 91 1e-22 Thylakoid soluble phosphoprotein TSP9
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015352)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 151
AciI CCGC 3 cut(s) 204, 207, 230
AclWI GGATC 1 cut(s) 155
AcoI YGGCCR 1 cut(s) 52
AcuI CTGAAG 1 cut(s) 191
AfaI GTAC 1 cut(s) 62
AfiI CCNNNNNNNGG 2 cut(s) 151, 175
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
AlwI GGATC 1 cut(s) 155
AlwNI CAGNNNCTG 1 cut(s) 151
AoxI GGCC 3 cut(s) 52, 75, 259
ApeKI GCWGC 2 cut(s) 65, 148
AspS9I GGNCC 2 cut(s) 104, 142
AsuHPI GGTGA 1 cut(s) 46
AsuNHI GCTAGC 1 cut(s) 130
AvaII GGWCC 2 cut(s) 104, 142
BaeGI GKGCMC 1 cut(s) 218
BbvI GCAGC 2 cut(s) 52, 135
BfaI CTAG 1 cut(s) 131
BisI GCNGC 5 cut(s) 66, 149, 205, 208, 230
BlsI GCNGC 5 cut(s) 67, 150, 206, 209, 231
Bme18I GGWCC 2 cut(s) 104, 142
BmgT120I GGNCC 2 cut(s) 104, 142
BmiI GGNNCC 2 cut(s) 105, 196
BmtI GCTAGC 1 cut(s) 134
BoxI GACNNNNGTC 1 cut(s) 17
BpmI CTGGAG 1 cut(s) 173
BsaJI CCNNGG 1 cut(s) 78
BsaWI WCCGGW 1 cut(s) 28
Bsc4I CCNNNNNNNGG 2 cut(s) 151, 175
Bse118I RCCGGY 1 cut(s) 50
Bse1I ACTGG 1 cut(s) 43
BseDI CCNNGG 1 cut(s) 78
BseLI CCNNNNNNNGG 2 cut(s) 151, 175
BseNI ACTGG 1 cut(s) 43
BseSI GKGCMC 1 cut(s) 218
BseXI GCAGC 2 cut(s) 52, 135
BshFI GGCC 3 cut(s) 54, 77, 261
BsiSI CCGG 2 cut(s) 29, 51
BslI CCNNNNNNNGG 2 cut(s) 151, 175
BsnI GGCC 3 cut(s) 54, 77, 261
Bsp1286I GDGCHC 1 cut(s) 218
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 3 cut(s) 204, 207, 230
BspANI GGCC 3 cut(s) 54, 77, 261
BspLI GGNNCC 2 cut(s) 105, 196
BspOI GCTAGC 1 cut(s) 134
BspPI GGATC 1 cut(s) 155
BsrFI RCCGGY 1 cut(s) 50
BsrI ACTGG 1 cut(s) 43
BssAI RCCGGY 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 78
BssMI GATC 1 cut(s) 160
BssT1I CCWWGG 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 220
BstC8I GCNNGC 1 cut(s) 132
BstENI CCTNNNNNAGG 1 cut(s) 173
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 3 cut(s) 74, 213, 258
BstPAI GACNNNNGTC 1 cut(s) 17
BstSLI GKGCMC 1 cut(s) 218
BstV1I GCAGC 2 cut(s) 52, 135
BsuRI GGCC 3 cut(s) 54, 77, 261
BtsIMutI CAGTG 1 cut(s) 216
Cac8I GCNNGC 1 cut(s) 132
CaiI CAGNNNCTG 1 cut(s) 151
Cfr10I RCCGGY 1 cut(s) 50
Cfr13I GGNCC 2 cut(s) 104, 142
Csp6I GTAC 1 cut(s) 61
CviJI RGCY 8 cut(s) 5, 54, 77, 130, 148, 224, 252, 261
CviKI_1 RGCY 8 cut(s) 5, 54, 77, 130, 148, 224, 252, 261
CviQI GTAC 1 cut(s) 61
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
EaeI YGGCCR 1 cut(s) 52
Eco130I CCWWGG 1 cut(s) 78
Eco147I AGGCCT 1 cut(s) 261
Eco47I GGWCC 2 cut(s) 104, 142
Eco57I CTGAAG 1 cut(s) 191
EcoNI CCTNNNNNAGG 1 cut(s) 173
EcoT14I CCWWGG 1 cut(s) 78
ErhI CCWWGG 1 cut(s) 78
Fnu4HI GCNGC 5 cut(s) 66, 149, 205, 208, 230
Fsp4HI GCNGC 5 cut(s) 66, 149, 205, 208, 230
FspBI CTAG 1 cut(s) 131
GluI GCNGC 5 cut(s) 66, 149, 205, 208, 230
GsuI CTGGAG 1 cut(s) 173
HaeIII GGCC 3 cut(s) 54, 77, 261
HapII CCGG 2 cut(s) 29, 51
HinfI GANTC 1 cut(s) 118
HpaII CCGG 2 cut(s) 29, 51
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 169
Hpy8I GTNNAC 1 cut(s) 61
HpyAV CCTTC 3 cut(s) 94, 169, 268
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4V TGCA 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 3 cut(s) 74, 213, 258
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 7 cut(s) 24, 42, 64, 137, 158, 182, 230
Lsp1109I GCAGC 2 cut(s) 52, 135
MaeI CTAG 1 cut(s) 131
MaeIII GTNAC 1 cut(s) 34
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 3 cut(s) 184, 247, 250
MhlI GDGCHC 1 cut(s) 218
MnlI CCTC 8 cut(s) 36, 67, 77, 119, 133, 148, 175, 251
MspA1I CMGCKG 2 cut(s) 148, 204
MspI CCGG 2 cut(s) 29, 51
MwoI GCNNNNNNNGC 3 cut(s) 74, 213, 258
NdeII GATC 1 cut(s) 160
NheI GCTAGC 1 cut(s) 130
NlaIV GGNNCC 2 cut(s) 105, 196
NmuCI GTSAC 1 cut(s) 34
PceI AGGCCT 1 cut(s) 261
PfeI GAWTC 1 cut(s) 118
PflMI CCANNNNNTGG 1 cut(s) 151
PkrI GCNGC 5 cut(s) 67, 150, 206, 209, 231
PshAI GACNNNNGTC 1 cut(s) 17
PspN4I GGNNCC 2 cut(s) 105, 196
PspPI GGNCC 2 cut(s) 104, 142
PstNI CAGNNNCTG 1 cut(s) 151
PvuII CAGCTG 1 cut(s) 148
RsaI GTAC 1 cut(s) 62
RsaNI GTAC 1 cut(s) 61
SatI GCNGC 5 cut(s) 66, 149, 205, 208, 230
Sau3AI GATC 1 cut(s) 160
Sau96I GGNCC 2 cut(s) 104, 142
SduI GDGCHC 1 cut(s) 218
SetI ASST 3 cut(s) 150, 159, 180
SinI GGWCC 2 cut(s) 104, 142
SseBI AGGCCT 1 cut(s) 261
SsiI CCGC 3 cut(s) 204, 207, 230
SspMI CTAG 1 cut(s) 131
StuI AGGCCT 1 cut(s) 261
StyI CCWWGG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 220
TauI GCSGC 3 cut(s) 207, 210, 232
TfiI GAWTC 1 cut(s) 118
TscAI CASTG 1 cut(s) 223
TseFI GTSAC 1 cut(s) 34
TseI GCWGC 2 cut(s) 65, 148
Tsp45I GTSAC 1 cut(s) 34
TspGWI ACGGA 3 cut(s) 86, 96, 187
TspRI CASTG 1 cut(s) 223
Van91I CCANNNNNTGG 1 cut(s) 151
VpaK11BI GGWCC 2 cut(s) 104, 142
XagI CCTNNNNNAGG 1 cut(s) 173
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.