MD12G1003500.v1.1

complex. Subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0012323
Physical Location & Seq
Forward (+)
520751 .. 529059
8309 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1003500.v1.1.491

Sequence Viewer

Length: 309 bp
ATGTACGAGAAGTATCCAAAAGGCCAATCAAGAGGGAGACATTGGAAACATCTCAAGCAGATCATTCAGGCTGAGAATTATCAGAATTACCCACCCGATGAACCAAATTATGTTAATATAGAATCCCCACCCTCTATGCATCCAAGCAAGAAAATTTGTGATATAACAGGATATGAGGCACCTTATTATGATCCAAGGACCAACCTCCGCTATGCCAATGCTGATATCTTCAAGCTCATAAGATCACTTCCAAATGAATATGTCCAAAGATATCTGGCTCTTAGAAATGCTGCTGTGGTTTTGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
YL1_C

Protein Analysis

103

Amino Acids

12.09

Weight (kDa)

9.32

Isoelectric Point (pI)

60.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
YL1_C PF08265 52 - 80 1.5e-14 YL1 nuclear protein C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 178
AciI CCGC 1 cut(s) 208
AclWI GGATC 1 cut(s) 185
AcsI RAATTY 1 cut(s) 153
AfaI GTAC 1 cut(s) 5
AgsI TTSAA 2 cut(s) 232, 304
AluBI AGCT 1 cut(s) 235
AluI AGCT 1 cut(s) 235
Alw26I GTCTC 1 cut(s) 31
AlwI GGATC 1 cut(s) 185
AoxI GGCC 1 cut(s) 22
ApeKI GCWGC 1 cut(s) 290
ApoI RAATTY 1 cut(s) 153
AspS9I GGNCC 1 cut(s) 198
AvaII GGWCC 1 cut(s) 198
BanI GGYRCC 1 cut(s) 178
BbvI GCAGC 1 cut(s) 277
BciVI GTATCC 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 31
BfuI GTATCC 1 cut(s) 24
BisI GCNGC 1 cut(s) 291
BlsI GCNGC 1 cut(s) 292
Bme18I GGWCC 1 cut(s) 198
BmgT120I GGNCC 1 cut(s) 198
BmiI GGNNCC 1 cut(s) 180
BmsI GCATC 1 cut(s) 148
BpuEI CTTGAG 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 194
BseDI CCNNGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 63
BseXI GCAGC 1 cut(s) 277
BshFI GGCC 1 cut(s) 24
BshNI GGYRCC 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 31
BsnI GGCC 1 cut(s) 24
Bsp143I GATC 3 cut(s) 60, 190, 242
BspACI CCGC 1 cut(s) 208
BspANI GGCC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 64
BspLI GGNNCC 1 cut(s) 180
BspPI GGATC 1 cut(s) 185
BspT107I GGYRCC 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 194
BssMI GATC 3 cut(s) 60, 190, 242
BssT1I CCWWGG 1 cut(s) 194
BstDEI CTNAG 2 cut(s) 72, 281
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 3 cut(s) 63, 193, 245
BstMAI GTCTC 1 cut(s) 31
BstMBI GATC 3 cut(s) 60, 190, 242
BstV1I GCAGC 1 cut(s) 277
BsuI GTATCC 1 cut(s) 24
BsuRI GGCC 1 cut(s) 24
BtsCI GGATG 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 198
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 4 cut(s) 24, 71, 235, 278
CviKI_1 RGCY 4 cut(s) 24, 71, 235, 278
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 2 cut(s) 72, 281
DpnI GATC 3 cut(s) 62, 192, 244
DpnII GATC 3 cut(s) 60, 190, 242
Eco130I CCWWGG 1 cut(s) 194
Eco32I GATATC 2 cut(s) 226, 272
Eco47I GGWCC 1 cut(s) 198
EcoRV GATATC 2 cut(s) 226, 272
EcoT14I CCWWGG 1 cut(s) 194
EcoT22I ATGCAT 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 194
FaiI YATR 9 cut(s) 111, 119, 137, 164, 174, 189, 213, 239, 261
Fnu4HI GCNGC 1 cut(s) 291
FokI GGATG 1 cut(s) 126
Fsp4HI GCNGC 1 cut(s) 291
GluI GCNGC 1 cut(s) 291
HaeIII GGCC 1 cut(s) 24
HinfI GANTC 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4V TGCA 1 cut(s) 139
HpyF3I CTNAG 2 cut(s) 72, 281
Kzo9I GATC 3 cut(s) 60, 190, 242
LpnPI CCDG 3 cut(s) 53, 153, 260
Lsp1109I GCAGC 1 cut(s) 277
LweI GCATC 1 cut(s) 148
MalI GATC 3 cut(s) 62, 192, 244
MboI GATC 3 cut(s) 60, 190, 242
MboII GAAGA 1 cut(s) 220
MluCI AATT 4 cut(s) 76, 85, 106, 153
MnlI CCTC 4 cut(s) 26, 142, 169, 215
Mph1103I ATGCAT 1 cut(s) 141
MseI TTAA 1 cut(s) 114
NdeII GATC 3 cut(s) 60, 190, 242
NlaIV GGNNCC 1 cut(s) 180
NsiI ATGCAT 1 cut(s) 141
PfeI GAWTC 1 cut(s) 122
PkrI GCNGC 1 cut(s) 292
PspN4I GGNNCC 1 cut(s) 180
PspPI GGNCC 1 cut(s) 198
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 114
SatI GCNGC 1 cut(s) 291
Sau3AI GATC 3 cut(s) 60, 190, 242
Sau96I GGNCC 1 cut(s) 198
SetI ASST 3 cut(s) 184, 207, 237
SfaNI GCATC 1 cut(s) 148
SinI GGWCC 1 cut(s) 198
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 4 cut(s) 76, 85, 106, 153
SsiI CCGC 1 cut(s) 208
StyI CCWWGG 1 cut(s) 194
TasI AATT 4 cut(s) 76, 85, 106, 153
TfiI GAWTC 1 cut(s) 122
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseI GCWGC 1 cut(s) 290
TspDTI ATGAA 2 cut(s) 114, 270
VpaK11BI GGWCC 1 cut(s) 198
XapI RAATTY 1 cut(s) 153
Zsp2I ATGCAT 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.