Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008837.1

Orthogroup ID

OG0012323

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 493

Gene Structure 493 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008837.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 172 bp

atggagcgagaggtgattcaagcagagctggtgttgccaaacaagctgagcttcaagagggttcagatgaatgagaagtacccaaaaggccagcccagagggagatggaaacacctcaaacagatcattcaggccgagaattatcacaactaccctcctgatgaacccaatt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

YL1_C

Protein Analysis

57

Amino Acids

6.89

Weight (kDa)

9.45

Isoelectric Point (pI)

46.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012323)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G38495
fragaria_vesca	FvH4_5g23580 FvH4_5g23580 FvH4_5g23580 FvH4_5g23580
malus_domestica	MD12G1003500.v1.1
prunus_persica	Prupe.7G004000_v2.0.a1 Prupe.7G004000_v2.0.a1 Prupe.7G004000_v2.0.a1
rosa_chinensis	RchiOBHm_Chr7g0212881
rosa_laevigata	RLG00000002862
rosa_multiflora	Rmu_sc0000394.1_g000053 Rmu_sc0008837.1_g000001
rosa_roxburghii	Rroxscaffold_3G00246480
rosa_rugosa	Rorug07G0137300
rosa_samantha	Rh7AG268900 Rh7CG287900 Rh7DG277000
rosa_wichuraiana	Rw7G023360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	80
AgsI	TTSAA	2 cut(s)	20, 55
AluBI	AGCT	3 cut(s)	28, 46, 51
AluI	AGCT	3 cut(s)	28, 46, 51
AoxI	GGCC	2 cut(s)	88, 132
AsuHPI	GGTGA	1 cut(s)	25
BccI	CCATC	1 cut(s)	99
BlpI	GCTNAGC	1 cut(s)	47
Bpu1102I	GCTNAGC	1 cut(s)	47
BseMII	CTCAG	1 cut(s)	38
BshFI	GGCC	2 cut(s)	90, 134
BsnI	GGCC	2 cut(s)	90, 134
Bsp143I	GATC	1 cut(s)	123
Bsp1720I	GCTNAGC	1 cut(s)	47
BspANI	GGCC	2 cut(s)	90, 134
BspCNI	CTCAG	1 cut(s)	39
BssMI	GATC	1 cut(s)	123
BstC8I	GCNNGC	1 cut(s)	92
BstDEI	CTNAG	1 cut(s)	47
BstKTI	GATC	1 cut(s)	126
BstMBI	GATC	1 cut(s)	123
BstMWI	GCNNNNNNNGC	2 cut(s)	34, 43
BsuRI	GGCC	2 cut(s)	90, 134
Cac8I	GCNNGC	1 cut(s)	92
Csp6I	GTAC	1 cut(s)	79
CviJI	RGCY	6 cut(s)	28, 46, 51, 90, 94, 134
CviKI_1	RGCY	6 cut(s)	28, 46, 51, 90, 94, 134
CviQI	GTAC	1 cut(s)	79
DdeI	CTNAG	1 cut(s)	47
DpnI	GATC	1 cut(s)	125
DpnII	GATC	1 cut(s)	123
FalI	AAGNNNNNCTT	2 cut(s)	35, 67
HaeIII	GGCC	2 cut(s)	90, 134
HinfI	GANTC	1 cut(s)	16
HphI	GGTGA	1 cut(s)	25
Hpy188I	TCNGA	1 cut(s)	66
Hpy188III	TCNNGA	2 cut(s)	55, 158
HpyF10VI	GCNNNNNNNGC	2 cut(s)	34, 43
HpyF3I	CTNAG	1 cut(s)	47
Kzo9I	GATC	1 cut(s)	123
LmnI	GCTCC	1 cut(s)	4
LpnPI	CCDG	4 cut(s)	14, 104, 109, 116
MalI	GATC	1 cut(s)	125
MboI	GATC	1 cut(s)	123
MluCI	AATT	1 cut(s)	139
MnlI	CCTC	5 cut(s)	4, 51, 92, 125, 165
MwoI	GCNNNNNNNGC	2 cut(s)	34, 43
NdeII	GATC	1 cut(s)	123
NmeAIII	GCCGAG	1 cut(s)	160
PfeI	GAWTC	1 cut(s)	16
RsaI	GTAC	1 cut(s)	80
RsaNI	GTAC	1 cut(s)	79
Sau3AI	GATC	1 cut(s)	123
SetI	ASST	5 cut(s)	15, 30, 48, 53, 117
SgeI	CNNG	9 cut(s)	20, 32, 41, 55, 67, 103, 108, 143, 148
Sse9I	AATT	1 cut(s)	139
TasI	AATT	1 cut(s)	139
TfiI	GAWTC	1 cut(s)	16
TspDTI	ATGAA	1 cut(s)	83

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.