MD12G1199400.v1.1

Anaphase-promoting complex subunit

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Reverse (-)
28041903 .. 28044225
2323 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1199400.v1.1.491

Sequence Viewer

Length: 174 bp
ATGGCATTTGATGGTTGTTGTCCCGATTGTAAACTCCCTGGGGATGATTGCCCACTAATTTGGGGTGCATGCAACCATGCGTTCCATCTTCATTGCATCTTAAAATGGGTAAATTCACAGACGTCTCAGGCACATTGCCCCATGTGCCGTAGGGAGTGGCAATTCAAAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.51

Weight (kDa)

6.86

Isoelectric Point (pI)

35.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-ANAPC11 PF12861 1 - 56 4.2e-30 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-rbx1 PF12678 2 - 50 2.8e-18 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017065)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G05870 AT3G05870 AT3G05870
malus_domestica MD04G1186000.v1.1 MD12G1199400.v1.1
prunus_persica Prupe.2G083700_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0458621
rosa_roxburghii Rroxscaffold_6G00420900
rosa_rugosa Rorug01G0032800
rosa_samantha Rh1AG044800 Rh1BG044600 Rh1DG051900
rosa_wichuraiana Rw3G007560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 112
AcyI GRCGYC 1 cut(s) 122
AgsI TTSAA 1 cut(s) 166
AjnI CCWGG 1 cut(s) 37
Alw26I GTCTC 1 cut(s) 129
ApoI RAATTY 1 cut(s) 112
BccI CCATC 2 cut(s) 5, 93
BceAI ACGGC 1 cut(s) 132
BciT130I CCWGG 1 cut(s) 39
BcoDI GTCTC 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 39
BmsI GCATC 1 cut(s) 105
BsaHI GRCGYC 1 cut(s) 122
BsaJI CCNNGG 2 cut(s) 37, 38
Bse3DI GCAATG 2 cut(s) 91, 133
BseBI CCWGG 1 cut(s) 39
BseDI CCNNGG 2 cut(s) 37, 38
BseGI GGATG 1 cut(s) 49
BseMI GCAATG 2 cut(s) 91, 133
BseMII CTCAG 1 cut(s) 140
BslFI GGGAC 1 cut(s) 6
BsmAI GTCTC 1 cut(s) 129
BsmBI CGTCTC 1 cut(s) 129
BsmFI GGGAC 1 cut(s) 6
BspCNI CTCAG 1 cut(s) 139
BsrDI GCAATG 2 cut(s) 91, 133
BssECI CCNNGG 2 cut(s) 37, 38
BssNI GRCGYC 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 39
BstACI GRCGYC 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 126
BstF5I GGATG 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 129
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstNI CCWGG 1 cut(s) 39
BstNSI RCATGY 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 37
BstXI CCANNNNNNTGG 1 cut(s) 60
BtsCI GGATG 1 cut(s) 49
Cac8I GCNNGC 1 cut(s) 70
CviAII CATG 3 cut(s) 69, 77, 142
DdeI CTNAG 1 cut(s) 126
EcoRII CCWGG 1 cut(s) 37
Esp3I CGTCTC 1 cut(s) 129
FaeI CATG 3 cut(s) 72, 80, 145
FaiI YATR 3 cut(s) 70, 78, 143
FaqI GGGAC 1 cut(s) 6
FatI CATG 3 cut(s) 68, 76, 141
FokI GGATG 1 cut(s) 56
Hin1I GRCGYC 1 cut(s) 122
Hin1II CATG 3 cut(s) 72, 80, 145
Hpy166II GTNNAC 1 cut(s) 32
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 1 cut(s) 32
HpyCH4IV ACGT 1 cut(s) 122
HpyCH4V TGCA 3 cut(s) 68, 72, 96
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 126
HpySE526I ACGT 1 cut(s) 122
Hsp92I GRCGYC 1 cut(s) 122
Hsp92II CATG 3 cut(s) 72, 80, 145
LpnPI CCDG 3 cut(s) 24, 51, 113
LweI GCATC 1 cut(s) 105
MaeII ACGT 1 cut(s) 122
MboII GAAGA 1 cut(s) 80
MluCI AATT 3 cut(s) 57, 112, 161
MseI TTAA 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
MwoI GCNNNNNNNGC 1 cut(s) 144
NlaIII CATG 3 cut(s) 72, 80, 145
NspI RCATGY 1 cut(s) 72
PaeI GCATGC 1 cut(s) 72
PasI CCCWGGG 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
SaqAI TTAA 1 cut(s) 101
ScrFI CCNGG 1 cut(s) 39
SetI ASST 1 cut(s) 125
SfaNI GCATC 1 cut(s) 105
SgeI CNNG 7 cut(s) 35, 50, 51, 81, 89, 140, 154
SphI GCATGC 1 cut(s) 72
Sse9I AATT 3 cut(s) 57, 112, 161
StyD4I CCNGG 1 cut(s) 37
TaiI ACGT 1 cut(s) 125
TasI AATT 3 cut(s) 57, 112, 161
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 80
XapI RAATTY 1 cut(s) 112
XceI RCATGY 1 cut(s) 72
ZraI GACGTC 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.