Rh1AG044800

Anaphase-promoting complex subunit 11 RING-H2 finger

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
7681981 .. 7687327
5347 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG044800.1

Sequence Viewer

Length: 270 bp
ATGTCGAAAATCCACGGAACCAAACAGAGCTTAGGGTGGCATGCTGTTGCTGCATGGACATGGGATGCTCAGGACGAAACATGTGGCATTTGTAGGATGGCATTTGATGGTTGTTGTCCTGATTGTAAGCTCCCTGGGGATGATTGTCCACTAATTTGGGGTGCATGCAACCATGCATTTCATCTTCATTGCATCCTAAAATGGGTAAATTCACAGACTTCTCAAGCACATTGCCCCATGTGCCGGAGGGAGTGGCAGTTCAAAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.08

Weight (kDa)

6.97

Isoelectric Point (pI)

39.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-ANAPC11 PF12861 25 - 88 2.3e-35 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-rbx1 PF12678 26 - 82 5.6e-22 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017065)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G05870 AT3G05870 AT3G05870
malus_domestica MD04G1186000.v1.1 MD12G1199400.v1.1
prunus_persica Prupe.2G083700_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0458621
rosa_roxburghii Rroxscaffold_6G00420900
rosa_rugosa Rorug01G0032800
rosa_samantha Rh1AG044800 Rh1BG044600 Rh1DG051900
rosa_wichuraiana Rw3G007560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 208
AfiI CCNNNNNNNGG 2 cut(s) 202, 243
AflIII ACRYGT 1 cut(s) 80
AgsI TTSAA 1 cut(s) 262
AjnI CCWGG 1 cut(s) 133
AloI GAACNNNNNNTCC 1 cut(s) 242
AluBI AGCT 2 cut(s) 30, 130
AluI AGCT 2 cut(s) 30, 130
ApeKI GCWGC 1 cut(s) 50
ApoI RAATTY 1 cut(s) 208
BbvI GCAGC 1 cut(s) 37
BccI CCATC 2 cut(s) 91, 101
BciT130I CCWGG 1 cut(s) 135
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
Bme1390I CCNGG 1 cut(s) 135
BmiI GGNNCC 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 135
BmsI GCATC 2 cut(s) 55, 201
Bpu10I CCTNAGC 2 cut(s) 31, 69
BpuEI CTTGAG 1 cut(s) 207
BsaJI CCNNGG 3 cut(s) 13, 133, 134
BsaXI ACNNNNNCTCC 1 cut(s) 242
Bsc4I CCNNNNNNNGG 2 cut(s) 202, 243
Bse3DI GCAATG 2 cut(s) 187, 229
BseBI CCWGG 1 cut(s) 135
BseDI CCNNGG 3 cut(s) 13, 133, 134
BseGI GGATG 4 cut(s) 70, 102, 145, 192
BseLI CCNNNNNNNGG 2 cut(s) 202, 243
BseMI GCAATG 2 cut(s) 187, 229
BseMII CTCAG 1 cut(s) 83
BseXI GCAGC 1 cut(s) 37
BsiSI CCGG 1 cut(s) 244
BslI CCNNNNNNNGG 2 cut(s) 202, 243
BspCNI CTCAG 1 cut(s) 82
BspLI GGNNCC 1 cut(s) 19
BsrDI GCAATG 2 cut(s) 187, 229
BssECI CCNNGG 3 cut(s) 13, 133, 134
Bst2UI CCWGG 1 cut(s) 135
BstC8I GCNNGC 2 cut(s) 42, 166
BstDEI CTNAG 2 cut(s) 31, 69
BstDSI CCRYGG 1 cut(s) 13
BstF5I GGATG 4 cut(s) 70, 102, 145, 192
BstMWI GCNNNNNNNGC 2 cut(s) 50, 240
BstNI CCWGG 1 cut(s) 135
BstNSI RCATGY 3 cut(s) 44, 84, 168
BstSCI CCNGG 1 cut(s) 133
BstV1I GCAGC 1 cut(s) 37
BstXI CCANNNNNNTGG 1 cut(s) 156
BtgI CCRYGG 1 cut(s) 13
BtsCI GGATG 4 cut(s) 70, 102, 145, 192
Cac8I GCNNGC 2 cut(s) 42, 166
CviAII CATG 7 cut(s) 41, 54, 60, 81, 165, 173, 238
CviJI RGCY 2 cut(s) 30, 130
CviKI_1 RGCY 2 cut(s) 30, 130
DdeI CTNAG 2 cut(s) 31, 69
EcoRII CCWGG 1 cut(s) 133
EcoT22I ATGCAT 1 cut(s) 178
FaeI CATG 7 cut(s) 44, 57, 63, 84, 168, 176, 241
FaiI YATR 7 cut(s) 42, 55, 61, 82, 166, 174, 239
FatI CATG 7 cut(s) 40, 53, 59, 80, 164, 172, 237
Fnu4HI GCNGC 1 cut(s) 51
FokI GGATG 4 cut(s) 77, 109, 152, 179
Fsp4HI GCNGC 1 cut(s) 51
GluI GCNGC 1 cut(s) 51
HapII CCGG 1 cut(s) 244
Hin1II CATG 7 cut(s) 44, 57, 63, 84, 168, 176, 241
HpaII CCGG 1 cut(s) 244
Hpy166II GTNNAC 1 cut(s) 149
Hpy188III TCNNGA 2 cut(s) 71, 119
Hpy8I GTNNAC 1 cut(s) 149
HpyCH4V TGCA 5 cut(s) 53, 164, 168, 176, 192
HpyF10VI GCNNNNNNNGC 2 cut(s) 50, 240
HpyF3I CTNAG 2 cut(s) 31, 69
Hsp92II CATG 7 cut(s) 44, 57, 63, 84, 168, 176, 241
LmnI GCTCC 1 cut(s) 135
LpnPI CCDG 5 cut(s) 56, 120, 132, 147, 257
Lsp1109I GCAGC 1 cut(s) 37
LweI GCATC 2 cut(s) 55, 201
MboII GAAGA 1 cut(s) 176
MluCI AATT 2 cut(s) 153, 208
MnlI CCTC 1 cut(s) 240
Mph1103I ATGCAT 1 cut(s) 178
MslI CAYNNNNRTG 1 cut(s) 58
MspI CCGG 1 cut(s) 244
MspR9I CCNGG 1 cut(s) 135
MvaI CCWGG 1 cut(s) 135
MwoI GCNNNNNNNGC 2 cut(s) 50, 240
NlaIII CATG 7 cut(s) 44, 57, 63, 84, 168, 176, 241
NlaIV GGNNCC 1 cut(s) 19
NsiI ATGCAT 1 cut(s) 178
NspI RCATGY 3 cut(s) 44, 84, 168
PaeI GCATGC 2 cut(s) 44, 168
PasI CCCWGGG 1 cut(s) 134
PciI ACATGT 1 cut(s) 80
PkrI GCNGC 1 cut(s) 52
PscI ACATGT 1 cut(s) 80
Psp6I CCWGG 1 cut(s) 133
PspGI CCWGG 1 cut(s) 133
PspN4I GGNNCC 1 cut(s) 19
RseI CAYNNNNRTG 1 cut(s) 58
SatI GCNGC 1 cut(s) 51
ScrFI CCNGG 1 cut(s) 135
SetI ASST 2 cut(s) 32, 132
SfaNI GCATC 2 cut(s) 55, 201
SmiMI CAYNNNNRTG 1 cut(s) 58
SmlI CTYRAG 1 cut(s) 222
SmoI CTYRAG 1 cut(s) 222
SphI GCATGC 2 cut(s) 44, 168
Sse9I AATT 2 cut(s) 153, 208
StyD4I CCNGG 1 cut(s) 133
TaqI TCGA 1 cut(s) 5
TasI AATT 2 cut(s) 153, 208
TseI GCWGC 1 cut(s) 50
TspDTI ATGAA 2 cut(s) 170, 176
TspGWI ACGGA 1 cut(s) 30
XapI RAATTY 1 cut(s) 208
XceI RCATGY 3 cut(s) 44, 84, 168
Zsp2I ATGCAT 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.