Prupe.2G083700_v2.0.a1

Anaphase-promoting complex subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
13277517 .. 13282658
5142 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G083700.1

Sequence Viewer

Length: 255 bp
ATGAAAGTCAACATCTTGCAGTGGCATGCTGTTGCTTCATGGACATGGGATGCACAAGATGAAACATGTGGGATTTGCAGGATGGCATTTGATGGTTGTTGTCCTGCTTGTAAACTCCCTGGGGATGATTGCCCACTAATTTGGGGTGCATGCAACCATGCGTTCCATCTTCATTGCATCTTAAAATGGGTAAATTCACAGACTTCTCAGGCGCATTGCCCCATGTGCCGCAGGGAGTGGCAATTCAAAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.61

Weight (kDa)

6.91

Isoelectric Point (pI)

46.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017065)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G05870 AT3G05870 AT3G05870
malus_domestica MD04G1186000.v1.1 MD12G1199400.v1.1
prunus_persica Prupe.2G083700_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0458621
rosa_roxburghii Rroxscaffold_6G00420900
rosa_rugosa Rorug01G0032800
rosa_samantha Rh1AG044800 Rh1BG044600 Rh1DG051900
rosa_wichuraiana Rw3G007560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 229
AcsI RAATTY 1 cut(s) 193
AflIII ACRYGT 1 cut(s) 65
AgsI TTSAA 1 cut(s) 247
AjnI CCWGG 1 cut(s) 118
ApoI RAATTY 1 cut(s) 193
AspLEI GCGC 1 cut(s) 214
BccI CCATC 3 cut(s) 76, 86, 174
BciT130I CCWGG 1 cut(s) 120
BisI GCNGC 1 cut(s) 229
BlsI GCNGC 1 cut(s) 230
Bme1390I CCNGG 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 120
BmsI GCATC 2 cut(s) 40, 186
BsaJI CCNNGG 2 cut(s) 118, 119
Bse3DI GCAATG 2 cut(s) 172, 214
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 2 cut(s) 118, 119
BseGI GGATG 3 cut(s) 55, 87, 130
BseMI GCAATG 2 cut(s) 172, 214
BseMII CTCAG 1 cut(s) 221
BspACI CCGC 1 cut(s) 229
BspCNI CTCAG 1 cut(s) 220
BsrDI GCAATG 2 cut(s) 172, 214
BssECI CCNNGG 2 cut(s) 118, 119
Bst2UI CCWGG 1 cut(s) 120
BstC8I GCNNGC 2 cut(s) 27, 151
BstDEI CTNAG 1 cut(s) 207
BstF5I GGATG 3 cut(s) 55, 87, 130
BstHHI GCGC 1 cut(s) 214
BstMWI GCNNNNNNNGC 1 cut(s) 225
BstNI CCWGG 1 cut(s) 120
BstNSI RCATGY 3 cut(s) 29, 69, 153
BstSCI CCNGG 1 cut(s) 118
BstXI CCANNNNNNTGG 1 cut(s) 141
BtsCI GGATG 3 cut(s) 55, 87, 130
BtsI GCAGTG 1 cut(s) 26
BtsIMutI CAGTG 1 cut(s) 26
Cac8I GCNNGC 2 cut(s) 27, 151
CfoI GCGC 1 cut(s) 214
CviAII CATG 7 cut(s) 26, 39, 45, 66, 150, 158, 223
DdeI CTNAG 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 118
FaeI CATG 7 cut(s) 29, 42, 48, 69, 153, 161, 226
FaiI YATR 7 cut(s) 27, 40, 46, 67, 151, 159, 224
FatI CATG 7 cut(s) 25, 38, 44, 65, 149, 157, 222
Fnu4HI GCNGC 1 cut(s) 229
FokI GGATG 3 cut(s) 62, 94, 137
Fsp4HI GCNGC 1 cut(s) 229
GlaI GCGC 1 cut(s) 213
GluI GCNGC 1 cut(s) 229
HhaI GCGC 1 cut(s) 214
Hin1II CATG 7 cut(s) 29, 42, 48, 69, 153, 161, 226
Hin6I GCGC 1 cut(s) 212
HinP1I GCGC 1 cut(s) 212
HincII GTYRAC 1 cut(s) 10
HindII GTYRAC 1 cut(s) 10
Hpy166II GTNNAC 2 cut(s) 10, 113
Hpy8I GTNNAC 2 cut(s) 10, 113
HpyCH4V TGCA 6 cut(s) 19, 53, 78, 149, 153, 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 225
HpyF3I CTNAG 1 cut(s) 207
Hsp92II CATG 7 cut(s) 29, 42, 48, 69, 153, 161, 226
HspAI GCGC 1 cut(s) 212
LpnPI CCDG 6 cut(s) 64, 105, 117, 132, 194, 217
LweI GCATC 2 cut(s) 40, 186
MboII GAAGA 1 cut(s) 161
MluCI AATT 3 cut(s) 138, 193, 242
MseI TTAA 1 cut(s) 182
MslI CAYNNNNRTG 1 cut(s) 43
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 225
NlaIII CATG 7 cut(s) 29, 42, 48, 69, 153, 161, 226
NspI RCATGY 3 cut(s) 29, 69, 153
PaeI GCATGC 2 cut(s) 29, 153
PasI CCCWGGG 1 cut(s) 119
PciI ACATGT 1 cut(s) 65
PkrI GCNGC 1 cut(s) 230
PscI ACATGT 1 cut(s) 65
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 43
SaqAI TTAA 1 cut(s) 182
SatI GCNGC 1 cut(s) 229
ScrFI CCNGG 1 cut(s) 120
SfaNI GCATC 2 cut(s) 40, 186
SmiMI CAYNNNNRTG 1 cut(s) 43
SphI GCATGC 2 cut(s) 29, 153
Sse9I AATT 3 cut(s) 138, 193, 242
SsiI CCGC 1 cut(s) 229
StyD4I CCNGG 1 cut(s) 118
TasI AATT 3 cut(s) 138, 193, 242
TauI GCSGC 1 cut(s) 231
Tru1I TTAA 1 cut(s) 182
Tru9I TTAA 1 cut(s) 182
TscAI CASTG 1 cut(s) 26
TspDTI ATGAA 4 cut(s) 17, 27, 75, 161
TspRI CASTG 1 cut(s) 26
XapI RAATTY 1 cut(s) 193
XceI RCATGY 3 cut(s) 29, 69, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.